Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0705702782:

Variant ID: vg0705702782 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5702782
Reference Allele: G	Alternative Allele: T,A
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:

TAGAATTTAGAAAATGAACTAAAAGCTAGAAGCTGACTACCAATCAGCTGCTTCTCATAATTTTAAGCTCCCCCAAACAGGCCCAAAGAGACCATTACAT[G/T,A]
CATGGACAAAGATGGTGCTCCCATTTACATAATGATAATTACATTTGAAGTTGTCAACAGGGAGGCTTCTCTTTCTGGTTCAAGAAAGACACCTCTTTTT

Reverse complement sequence

AAAAAGAGGTGTCTTTCTTGAACCAGAAAGAGAAGCCTCCCTGTTGACAACTTCAAATGTAATTATCATTATGTAAATGGGAGCACCATCTTTGTCCATG[C/A,T]
ATGTAATGGTCTCTTTGGGCCTGTTTGGGGGAGCTTAAAATTATGAGAAGCAGCTGATTGGTAGTCAGCTTCTAGCTTTTAGTTCATTTTCTAAATTCTA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	94.90%	4.10%	0.53%	0.40%	A: 0.04%
All Indica	2759	95.40%	3.40%	0.76%	0.43%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	61.70%	34.60%	1.49%	2.23%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	97.40%	1.50%	0.86%	0.22%	NA
Indica III	913	92.70%	5.80%	0.99%	0.55%	NA
Indica Intermediate	786	94.00%	4.20%	1.02%	0.76%	NA
Temperate Japonica	767	100.00%	0.00%	0.00%	0.00%	NA
Tropical Japonica	504	100.00%	0.00%	0.00%	0.00%	NA
Japonica Intermediate	241	99.60%	0.40%	0.00%	0.00%	NA
VI/Aromatic	96	97.90%	2.10%	0.00%	0.00%	NA
Intermediate	90	93.30%	3.30%	0.00%	1.11%	A: 2.22%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705702782	G -> DEL	N	N	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> A	LOC_Os07g10540.1	upstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> A	LOC_Os07g10540.2	upstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> A	LOC_Os07g10550.1	downstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> A	LOC_Os07g10540-LOC_Os07g10550	intergenic_region ; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> T	LOC_Os07g10540.1	upstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> T	LOC_Os07g10540.2	upstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> T	LOC_Os07g10550.1	downstream_gene_variant ; 1.0bp to feature; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N
vg0705702782	G -> T	LOC_Os07g10540-LOC_Os07g10550	intergenic_region ; MODIFIER	silent_mutation	Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705702782	2.29E-09	NA	mr1682	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782	NA	1.07E-09	mr1722	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782	8.13E-06	NA	mr1754	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782	7.66E-06	3.34E-15	mr1530_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782	NA	1.60E-06	mr1815_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251