\
| Variant ID: vg0705702782 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5702782 |
| Reference Allele: G | Alternative Allele: T,A |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 254. )
TAGAATTTAGAAAATGAACTAAAAGCTAGAAGCTGACTACCAATCAGCTGCTTCTCATAATTTTAAGCTCCCCCAAACAGGCCCAAAGAGACCATTACAT[G/T,A]
CATGGACAAAGATGGTGCTCCCATTTACATAATGATAATTACATTTGAAGTTGTCAACAGGGAGGCTTCTCTTTCTGGTTCAAGAAAGACACCTCTTTTT
AAAAAGAGGTGTCTTTCTTGAACCAGAAAGAGAAGCCTCCCTGTTGACAACTTCAAATGTAATTATCATTATGTAAATGGGAGCACCATCTTTGTCCATG[C/A,T]
ATGTAATGGTCTCTTTGGGCCTGTTTGGGGGAGCTTAAAATTATGAGAAGCAGCTGATTGGTAGTCAGCTTCTAGCTTTTAGTTCATTTTCTAAATTCTA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 94.90% | 4.10% | 0.53% | 0.40% | A: 0.04% |
| All Indica | 2759 | 95.40% | 3.40% | 0.76% | 0.43% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 61.70% | 34.60% | 1.49% | 2.23% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.40% | 1.50% | 0.86% | 0.22% | NA |
| Indica III | 913 | 92.70% | 5.80% | 0.99% | 0.55% | NA |
| Indica Intermediate | 786 | 94.00% | 4.20% | 1.02% | 0.76% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 97.90% | 2.10% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 93.30% | 3.30% | 0.00% | 1.11% | A: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705702782 | G -> DEL | N | N | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> A | LOC_Os07g10540.1 | upstream_gene_variant ; 2899.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> A | LOC_Os07g10540.2 | upstream_gene_variant ; 2899.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> A | LOC_Os07g10550.1 | downstream_gene_variant ; 1.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> A | LOC_Os07g10540-LOC_Os07g10550 | intergenic_region ; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> T | LOC_Os07g10540.1 | upstream_gene_variant ; 2899.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> T | LOC_Os07g10540.2 | upstream_gene_variant ; 2899.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> T | LOC_Os07g10550.1 | downstream_gene_variant ; 1.0bp to feature; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| vg0705702782 | G -> T | LOC_Os07g10540-LOC_Os07g10550 | intergenic_region ; MODIFIER | silent_mutation | Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705702782 | 2.29E-09 | NA | mr1682 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705702782 | NA | 1.07E-09 | mr1722 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705702782 | 8.13E-06 | NA | mr1754 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705702782 | 7.66E-06 | 3.34E-15 | mr1530_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705702782 | NA | 1.60E-06 | mr1815_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |