\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705702782:

Variant ID: vg0705702782 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5702782
Reference Allele: GAlternative Allele: T,A
Primary Allele: GSecondary Allele: T

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


TAGAATTTAGAAAATGAACTAAAAGCTAGAAGCTGACTACCAATCAGCTGCTTCTCATAATTTTAAGCTCCCCCAAACAGGCCCAAAGAGACCATTACAT[G/T,A]
CATGGACAAAGATGGTGCTCCCATTTACATAATGATAATTACATTTGAAGTTGTCAACAGGGAGGCTTCTCTTTCTGGTTCAAGAAAGACACCTCTTTTT

Reverse complement sequence

AAAAAGAGGTGTCTTTCTTGAACCAGAAAGAGAAGCCTCCCTGTTGACAACTTCAAATGTAATTATCATTATGTAAATGGGAGCACCATCTTTGTCCATG[C/A,T]
ATGTAATGGTCTCTTTGGGCCTGTTTGGGGGAGCTTAAAATTATGAGAAGCAGCTGATTGGTAGTCAGCTTCTAGCTTTTAGTTCATTTTCTAAATTCTA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 94.90% 4.10% 0.53% 0.40% A: 0.04%
All Indica  2759 95.40% 3.40% 0.76% 0.43% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 61.70% 34.60% 1.49% 2.23% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 97.40% 1.50% 0.86% 0.22% NA
Indica III  913 92.70% 5.80% 0.99% 0.55% NA
Indica Intermediate  786 94.00% 4.20% 1.02% 0.76% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.60% 0.40% 0.00% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 93.30% 3.30% 0.00% 1.11% A: 2.22%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705702782 G -> DEL N N silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> A LOC_Os07g10540.1 upstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> A LOC_Os07g10540.2 upstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> A LOC_Os07g10550.1 downstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> A LOC_Os07g10540-LOC_Os07g10550 intergenic_region ; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> T LOC_Os07g10540.1 upstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> T LOC_Os07g10540.2 upstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> T LOC_Os07g10550.1 downstream_gene_variant ; 1.0bp to feature; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N
vg0705702782 G -> T LOC_Os07g10540-LOC_Os07g10550 intergenic_region ; MODIFIER silent_mutation Average:53.019; most accessible tissue: Zhenshan97 young leaf, score: 70.177 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705702782 2.29E-09 NA mr1682 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782 NA 1.07E-09 mr1722 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782 8.13E-06 NA mr1754 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782 7.66E-06 3.34E-15 mr1530_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705702782 NA 1.60E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251