Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705658607:

Variant ID: vg0705658607 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 5658607
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

CGAAAACGGAATCTGTCGGTCGGAATTTTTTCGGAATTTTTCGGAAACGGAAACGAATTCAGAAATATTTTCTCAGAAATGGAATCGGAAATGATAAGGG[C/T]
AGTTTCCGTCGGAACTCGGAATCGGTCGGAAACTTTCCGGAAATTTTCTCGAAATTACCAGAAATTTTGTGACTGAAATATCCTGGATTCTCTTTTTAAG

Reverse complement sequence

CTTAAAAAGAGAATCCAGGATATTTCAGTCACAAAATTTCTGGTAATTTCGAGAAAATTTCCGGAAAGTTTCCGACCGATTCCGAGTTCCGACGGAAACT[G/A]
CCCTTATCATTTCCGATTCCATTTCTGAGAAAATATTTCTGAATTCGTTTCCGTTTCCGAAAAATTCCGAAAAAATTCCGACCGACAGATTCCGTTTTCG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	74.50%	25.40%	0.11%	0.00%	NA
All Indica	2759	59.30%	40.60%	0.14%	0.00%	NA
All Japonica	1512	99.90%	0.10%	0.00%	0.00%	NA
Aus	269	72.10%	27.50%	0.37%	0.00%	NA
Indica I	595	78.30%	21.50%	0.17%	0.00%	NA
Indica II	465	80.20%	19.80%	0.00%	0.00%	NA
Indica III	913	33.40%	66.50%	0.11%	0.00%	NA
Indica Intermediate	786	62.60%	37.20%	0.25%	0.00%	NA
Temperate Japonica	767	99.90%	0.10%	0.00%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	100.00%	0.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	94.40%	5.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0705658607	C -> T	LOC_Os07g10520.1	upstream_gene_variant ; 1044.0bp to feature; MODIFIER	silent_mutation	Average:45.536; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0705658607	C -> T	LOC_Os07g10495.1	downstream_gene_variant ; 4753.0bp to feature; MODIFIER	silent_mutation	Average:45.536; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0705658607	C -> T	LOC_Os07g10500.1	downstream_gene_variant ; 1634.0bp to feature; MODIFIER	silent_mutation	Average:45.536; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0705658607	C -> T	LOC_Os07g10510.1	downstream_gene_variant ; 445.0bp to feature; MODIFIER	silent_mutation	Average:45.536; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N
vg0705658607	C -> T	LOC_Os07g10500-LOC_Os07g10510	intergenic_region ; MODIFIER	silent_mutation	Average:45.536; most accessible tissue: Zhenshan97 panicle, score: 61.671	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0705658607	NA	2.07E-07	mr1213	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	5.16E-06	mr1380	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	6.27E-07	mr1380	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	3.80E-07	mr1561	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	3.36E-07	mr1561	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	2.43E-06	mr1653	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	8.37E-07	mr1870	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	9.12E-07	mr1875	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	2.33E-06	2.33E-06	mr1875	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	1.12E-06	mr1908	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	5.91E-06	mr1908	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	9.10E-06	mr1937	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	6.60E-06	mr1159_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	1.59E-06	mr1159_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	1.54E-06	mr1380_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	5.03E-07	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	1.85E-06	mr1561_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	6.20E-08	mr1653_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705658607	NA	8.16E-08	mr1870_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251