\
| Variant ID: vg0705453437 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5453437 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.72, A: 0.28, others allele: 0.00, population size: 236. )
TGTAGACAGTGTTGAGCTACTACTTAAGAGAGAGAAAGTGAGTGAGTGGTGGTCAGTAGTCATAGACTAAAGGCCCAACTTTTGCCTTAATGAACTGGTT[A/G]
CAAACATTAGTTTTAAAAGAAGAATGGGGATCGACTGGTGTGCATAAGTGCATGTTGGTATATTATTGTTTTCTCTCATAGATGTGAGTAAGTTTTGAAT
ATTCAAAACTTACTCACATCTATGAGAGAAAACAATAATATACCAACATGCACTTATGCACACCAGTCGATCCCCATTCTTCTTTTAAAACTAATGTTTG[T/C]
AACCAGTTCATTAAGGCAAAAGTTGGGCCTTTAGTCTATGACTACTGACCACCACTCACTCACTTTCTCTCTCTTAAGTAGTAGCTCAACACTGTCTACA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 93.40% | 6.60% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 98.00% | 2.00% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Aus | 269 | 27.50% | 72.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.30% | 0.25% | 0.00% | NA |
| Temperate Japonica | 767 | 94.50% | 5.50% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 95.90% | 4.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 95.80% | 4.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705453437 | A -> G | LOC_Os07g10139.1 | downstream_gene_variant ; 2862.0bp to feature; MODIFIER | silent_mutation | Average:61.388; most accessible tissue: Zhenshan97 flower, score: 75.194 | N | N | N | N |
| vg0705453437 | A -> G | LOC_Os07g10150.1 | intron_variant ; MODIFIER | silent_mutation | Average:61.388; most accessible tissue: Zhenshan97 flower, score: 75.194 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705453437 | 1.72E-06 | 1.72E-06 | mr1197 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 4.68E-08 | 1.40E-60 | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 2.14E-13 | 1.42E-72 | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 3.05E-07 | mr1621 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 3.48E-16 | 3.83E-74 | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 1.71E-08 | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 1.34E-06 | mr1762 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 8.88E-06 | mr1928 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 5.31E-08 | mr1931 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 6.29E-29 | 5.82E-74 | mr1549_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 2.51E-13 | 1.06E-14 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 1.49E-24 | 4.46E-89 | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 1.47E-09 | 2.68E-10 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 5.14E-23 | 1.01E-62 | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | 2.02E-10 | 2.80E-12 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705453437 | NA | 3.66E-07 | mr1762_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |