\
| Variant ID: vg0705427326 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5427326 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AAAGTTTTGACGTGTCACATCGGGTATTATATAGGGTGTCATATGATGTGTTCAGGCACTAATAAAAAAACTAATTACAGAATCCGTCGGTAAACTGTGA[C/G]
ACGAATTTATTAAGCCTAATTAATCCGTTATTAGCTAATGTTTATTGTAGCATCACATTGTCAAATCATGAAGCAATTAGGCTTAAAAGATTCGTCTCGC
GCGAGACGAATCTTTTAAGCCTAATTGCTTCATGATTTGACAATGTGATGCTACAATAAACATTAGCTAATAACGGATTAATTAGGCTTAATAAATTCGT[G/C]
TCACAGTTTACCGACGGATTCTGTAATTAGTTTTTTTATTAGTGCCTGAACACATCATATGACACCCTATATAATACCCGATGTGACACGTCAAAACTTT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 35.20% | 0.00% | 1.33% | NA |
| All Indica | 2759 | 97.20% | 2.50% | 0.00% | 0.29% | NA |
| All Japonica | 1512 | 0.30% | 96.30% | 0.00% | 3.37% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 96.30% | 3.40% | 0.00% | 0.33% | NA |
| Indica Intermediate | 786 | 96.60% | 2.80% | 0.00% | 0.64% | NA |
| Temperate Japonica | 767 | 0.10% | 94.40% | 0.00% | 5.48% | NA |
| Tropical Japonica | 504 | 0.40% | 99.60% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.80% | 95.40% | 0.00% | 3.73% | NA |
| VI/Aromatic | 96 | 3.10% | 93.80% | 0.00% | 3.12% | NA |
| Intermediate | 90 | 45.60% | 53.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705427326 | C -> DEL | N | N | silent_mutation | Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0705427326 | C -> G | LOC_Os07g10110.1 | upstream_gene_variant ; 754.0bp to feature; MODIFIER | silent_mutation | Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0705427326 | C -> G | LOC_Os07g10120.1 | upstream_gene_variant ; 4227.0bp to feature; MODIFIER | silent_mutation | Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| vg0705427326 | C -> G | LOC_Os07g10110-LOC_Os07g10120 | intergenic_region ; MODIFIER | silent_mutation | Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705427326 | NA | 2.38E-34 | mr1081 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 6.94E-39 | mr1082 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 2.04E-45 | mr1092 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 5.83E-46 | mr1152 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 1.68E-06 | NA | mr1549 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 5.64E-06 | NA | mr1550 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 7.94E-12 | NA | mr1757 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 6.30E-06 | NA | mr1757 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 8.90E-55 | mr1861 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 8.77E-29 | mr1922 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 3.38E-13 | mr1924 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 4.75E-27 | mr1074_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 4.02E-32 | mr1081_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 1.68E-35 | mr1107_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 3.71E-18 | mr1239_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 2.29E-13 | mr1326_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 4.03E-15 | mr1333_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 8.74E-08 | mr1335_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 3.30E-24 | mr1386_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 2.01E-17 | NA | mr1549_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 2.84E-11 | 1.37E-11 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 9.97E-13 | NA | mr1550_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 6.32E-08 | 6.12E-08 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 7.54E-07 | mr1623_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | NA | 4.93E-16 | mr1686_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 1.94E-16 | NA | mr1757_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705427326 | 1.26E-09 | 9.36E-10 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |