\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705427326:

Variant ID: vg0705427326 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5427326
Reference Allele: CAlternative Allele: G
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAGTTTTGACGTGTCACATCGGGTATTATATAGGGTGTCATATGATGTGTTCAGGCACTAATAAAAAAACTAATTACAGAATCCGTCGGTAAACTGTGA[C/G]
ACGAATTTATTAAGCCTAATTAATCCGTTATTAGCTAATGTTTATTGTAGCATCACATTGTCAAATCATGAAGCAATTAGGCTTAAAAGATTCGTCTCGC

Reverse complement sequence

GCGAGACGAATCTTTTAAGCCTAATTGCTTCATGATTTGACAATGTGATGCTACAATAAACATTAGCTAATAACGGATTAATTAGGCTTAATAAATTCGT[G/C]
TCACAGTTTACCGACGGATTCTGTAATTAGTTTTTTTATTAGTGCCTGAACACATCATATGACACCCTATATAATACCCGATGTGACACGTCAAAACTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 35.20% 0.00% 1.33% NA
All Indica  2759 97.20% 2.50% 0.00% 0.29% NA
All Japonica  1512 0.30% 96.30% 0.00% 3.37% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 97.00% 3.00% 0.00% 0.00% NA
Indica III  913 96.30% 3.40% 0.00% 0.33% NA
Indica Intermediate  786 96.60% 2.80% 0.00% 0.64% NA
Temperate Japonica  767 0.10% 94.40% 0.00% 5.48% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 0.80% 95.40% 0.00% 3.73% NA
VI/Aromatic  96 3.10% 93.80% 0.00% 3.12% NA
Intermediate  90 45.60% 53.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705427326 C -> DEL N N silent_mutation Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0705427326 C -> G LOC_Os07g10110.1 upstream_gene_variant ; 754.0bp to feature; MODIFIER silent_mutation Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0705427326 C -> G LOC_Os07g10120.1 upstream_gene_variant ; 4227.0bp to feature; MODIFIER silent_mutation Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg0705427326 C -> G LOC_Os07g10110-LOC_Os07g10120 intergenic_region ; MODIFIER silent_mutation Average:47.535; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705427326 NA 2.38E-34 mr1081 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 6.94E-39 mr1082 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 2.04E-45 mr1092 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 5.83E-46 mr1152 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 1.68E-06 NA mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 5.64E-06 NA mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 7.94E-12 NA mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 6.30E-06 NA mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 8.90E-55 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 8.77E-29 mr1922 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 3.38E-13 mr1924 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 4.75E-27 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 4.02E-32 mr1081_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 1.68E-35 mr1107_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 3.71E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 2.29E-13 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 4.03E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 8.74E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 3.30E-24 mr1386_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 2.01E-17 NA mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 2.84E-11 1.37E-11 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 9.97E-13 NA mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 6.32E-08 6.12E-08 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 7.54E-07 mr1623_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 NA 4.93E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 1.94E-16 NA mr1757_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705427326 1.26E-09 9.36E-10 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251