Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0705335233:

Variant ID: vg0705335233 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5335233
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.97, T: 0.02, others allele: 0.00, population size: 39. )

Flanking Sequence (100 bp) in Reference Genome:


CTCTATGTCATGACGATGATATTTGTCTATGTCAATTACTCTATGTAGTTTAGAAGTGGTGTCTAGATTACGAGATATCATTATTTGGGGTTATATGCTG[C/T]
GGATGAGAGGTGGGCCGCTGTGTAGACCCCCGATTTTGGAAATCGGAAATCTTCTGTGTTTATCCGTACCAATCCCTGGATCAGTAGTTGGTACACACAT

Reverse complement sequence

ATGTGTGTACCAACTACTGATCCAGGGATTGGTACGGATAAACACAGAAGATTTCCGATTTCCAAAATCGGGGGTCTACACAGCGGCCCACCTCTCATCC[G/A]
CAGCATATAACCCCAAATAATGATATCTCGTAATCTAGACACCACTTCTAAACTACATAGAGTAATTGACATAGACAAATATCATCGTCATGACATAGAG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 59.40% 39.70% 0.15% 0.78% NA
All Indica  2759 90.50% 9.40% 0.11% 0.00% NA
All Japonica  1512 0.50% 96.80% 0.20% 2.45% NA
Aus  269 97.40% 2.20% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 91.20% 8.80% 0.00% 0.00% NA
Indica III  913 85.30% 14.50% 0.22% 0.00% NA
Indica Intermediate  786 89.30% 10.60% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 95.40% 0.39% 3.91% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.70% 95.40% 0.00% 2.90% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 37.80% 62.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705335233 C -> DEL N N silent_mutation Average:20.662; most accessible tissue: Callus, score: 32.083 N N N N
vg0705335233 C -> T LOC_Os07g10000.1 upstream_gene_variant ; 4676.0bp to feature; MODIFIER silent_mutation Average:20.662; most accessible tissue: Callus, score: 32.083 N N N N
vg0705335233 C -> T LOC_Os07g09990.1 downstream_gene_variant ; 2173.0bp to feature; MODIFIER silent_mutation Average:20.662; most accessible tissue: Callus, score: 32.083 N N N N
vg0705335233 C -> T LOC_Os07g09990-LOC_Os07g10000 intergenic_region ; MODIFIER silent_mutation Average:20.662; most accessible tissue: Callus, score: 32.083 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705335233 NA 2.59E-30 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.47E-30 mr1075 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.30E-20 mr1077 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.92E-46 mr1124 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.14E-07 mr1124 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 3.31E-32 mr1202 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.29E-11 mr1325 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 4.10E-13 mr1326 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.94E-13 mr1441 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.52E-15 mr1592 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.53E-12 mr1744 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.16E-53 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 4.10E-63 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 4.14E-06 4.14E-06 mr1955 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.86E-64 mr1962 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 9.33E-59 mr1067_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.83E-41 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.60E-09 mr1072_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.75E-40 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 6.67E-09 mr1075_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 6.21E-24 mr1077_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 9.12E-61 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 3.59E-09 mr1124_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 8.15E-27 mr1149_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.77E-08 mr1149_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.11E-13 mr1325_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.83E-14 mr1326_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.00E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 3.45E-16 mr1342_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 5.81E-27 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.53E-08 mr1441_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.24E-19 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 3.84E-07 mr1592_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.24E-10 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 7.24E-08 mr1600_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.93E-16 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.82E-08 mr1690_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.87E-07 mr1783_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 1.51E-52 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705335233 NA 2.52E-34 mr1888_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251