\
| Variant ID: vg0705275989 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 5275989 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTGAATTTGAAAATATGATAACTTCAAACAATATTTTCAAATACTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGTTGTATAACTCATCAATAT[C/T]
TATAACTTTTATTTTGGTCATTTCTTCATCCGAAAAAGTGATAGTAACATTGTTCACAAAATTCACATATCTCTCATCTGGTTTATAAACTATAACACAT
ATGTGTTATAGTTTATAAACCAGATGAGAGATATGTGAATTTTGTGAACAATGTTACTATCACTTTTTCGGATGAAGAAATGACCAAAATAAAAGTTATA[G/A]
ATATTGATGAGTTATACAACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTATCATATTTTCAAATTCAA
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 58.60% | 1.50% | 2.81% | 37.09% | NA |
| All Indica | 2759 | 37.80% | 0.00% | 4.60% | 57.56% | NA |
| All Japonica | 1512 | 95.00% | 4.60% | 0.00% | 0.33% | NA |
| Aus | 269 | 49.40% | 0.00% | 1.86% | 48.70% | NA |
| Indica I | 595 | 14.50% | 0.00% | 2.69% | 82.86% | NA |
| Indica II | 465 | 35.50% | 0.00% | 2.37% | 62.15% | NA |
| Indica III | 913 | 54.00% | 0.00% | 7.01% | 38.99% | NA |
| Indica Intermediate | 786 | 38.20% | 0.00% | 4.58% | 57.25% | NA |
| Temperate Japonica | 767 | 91.90% | 8.00% | 0.00% | 0.13% | NA |
| Tropical Japonica | 504 | 99.60% | 0.00% | 0.00% | 0.40% | NA |
| Japonica Intermediate | 241 | 95.40% | 3.70% | 0.00% | 0.83% | NA |
| VI/Aromatic | 96 | 97.90% | 0.00% | 0.00% | 2.08% | NA |
| Intermediate | 90 | 68.90% | 0.00% | 1.11% | 30.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0705275989 | C -> DEL | N | N | silent_mutation | Average:9.559; most accessible tissue: Callus, score: 25.935 | N | N | N | N |
| vg0705275989 | C -> T | LOC_Os07g09910.1 | upstream_gene_variant ; 2570.0bp to feature; MODIFIER | silent_mutation | Average:9.559; most accessible tissue: Callus, score: 25.935 | N | N | N | N |
| vg0705275989 | C -> T | LOC_Os07g09914.1 | upstream_gene_variant ; 953.0bp to feature; MODIFIER | silent_mutation | Average:9.559; most accessible tissue: Callus, score: 25.935 | N | N | N | N |
| vg0705275989 | C -> T | LOC_Os07g09910-LOC_Os07g09914 | intergenic_region ; MODIFIER | silent_mutation | Average:9.559; most accessible tissue: Callus, score: 25.935 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0705275989 | 1.19E-06 | 4.21E-08 | mr1549_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705275989 | NA | 4.31E-06 | mr1550_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705275989 | 4.53E-07 | 1.94E-08 | mr1588_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0705275989 | NA | 2.22E-06 | mr1757_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |