\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).


Sorry, variation is wrong, please check.

Sorry, variation is wrong, please check.

Detailed information for vg0705275989:

Variant ID: vg0705275989 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5275989
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTGAATTTGAAAATATGATAACTTCAAACAATATTTTCAAATACTAAATGATTTCAACTGAAAAAGTTATCAACAACAAAGTTGTATAACTCATCAATAT[C/T]
TATAACTTTTATTTTGGTCATTTCTTCATCCGAAAAAGTGATAGTAACATTGTTCACAAAATTCACATATCTCTCATCTGGTTTATAAACTATAACACAT

Reverse complement sequence

ATGTGTTATAGTTTATAAACCAGATGAGAGATATGTGAATTTTGTGAACAATGTTACTATCACTTTTTCGGATGAAGAAATGACCAAAATAAAAGTTATA[G/A]
ATATTGATGAGTTATACAACTTTGTTGTTGATAACTTTTTCAGTTGAAATCATTTAGTATTTGAAAATATTGTTTGAAGTTATCATATTTTCAAATTCAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.60% 1.50% 2.81% 37.09% NA
All Indica  2759 37.80% 0.00% 4.60% 57.56% NA
All Japonica  1512 95.00% 4.60% 0.00% 0.33% NA
Aus  269 49.40% 0.00% 1.86% 48.70% NA
Indica I  595 14.50% 0.00% 2.69% 82.86% NA
Indica II  465 35.50% 0.00% 2.37% 62.15% NA
Indica III  913 54.00% 0.00% 7.01% 38.99% NA
Indica Intermediate  786 38.20% 0.00% 4.58% 57.25% NA
Temperate Japonica  767 91.90% 8.00% 0.00% 0.13% NA
Tropical Japonica  504 99.60% 0.00% 0.00% 0.40% NA
Japonica Intermediate  241 95.40% 3.70% 0.00% 0.83% NA
VI/Aromatic  96 97.90% 0.00% 0.00% 2.08% NA
Intermediate  90 68.90% 0.00% 1.11% 30.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705275989 C -> DEL N N silent_mutation Average:9.559; most accessible tissue: Callus, score: 25.935 N N N N
vg0705275989 C -> T LOC_Os07g09910.1 upstream_gene_variant ; 2570.0bp to feature; MODIFIER silent_mutation Average:9.559; most accessible tissue: Callus, score: 25.935 N N N N
vg0705275989 C -> T LOC_Os07g09914.1 upstream_gene_variant ; 953.0bp to feature; MODIFIER silent_mutation Average:9.559; most accessible tissue: Callus, score: 25.935 N N N N
vg0705275989 C -> T LOC_Os07g09910-LOC_Os07g09914 intergenic_region ; MODIFIER silent_mutation Average:9.559; most accessible tissue: Callus, score: 25.935 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705275989 1.19E-06 4.21E-08 mr1549_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705275989 NA 4.31E-06 mr1550_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705275989 4.53E-07 1.94E-08 mr1588_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705275989 NA 2.22E-06 mr1757_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251