\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0705225777:

Variant ID: vg0705225777 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 5225777
Reference Allele: CAlternative Allele: T
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 254. )

Flanking Sequence (100 bp) in Reference Genome:


ACACTGTGAGCCATGCCTTTCTTATTGCTCCATTGTATGCATTGAAATTCTTATTATATATTGACACAATTAGGTGCCCAAACTGGCAGGTATCGATGCA[C/T]
TGACTATGCATTGTGCTGGCAGTAGGGCTAAGCTAGGGGGATCATATTGCTGGACTGGTGACAAGTTAAATGTTTGTTAAGGTACAAGTCATTTTATTGA

Reverse complement sequence

TCAATAAAATGACTTGTACCTTAACAAACATTTAACTTGTCACCAGTCCAGCAATATGATCCCCCTAGCTTAGCCCTACTGCCAGCACAATGCATAGTCA[G/A]
TGCATCGATACCTGCCAGTTTGGGCACCTAATTGTGTCAATATATAATAAGAATTTCAATGCATACAATGGAGCAATAAGAAAGGCATGGCTCACAGTGT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.40% 41.50% 0.08% 0.00% NA
All Indica  2759 88.70% 11.10% 0.14% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 98.10% 1.90% 0.00% 0.00% NA
Indica I  595 95.30% 4.50% 0.17% 0.00% NA
Indica II  465 92.30% 7.50% 0.22% 0.00% NA
Indica III  913 82.30% 17.60% 0.11% 0.00% NA
Indica Intermediate  786 89.20% 10.70% 0.13% 0.00% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.40% 99.60% 0.00% 0.00% NA
Japonica Intermediate  241 1.20% 98.80% 0.00% 0.00% NA
VI/Aromatic  96 5.20% 94.80% 0.00% 0.00% NA
Intermediate  90 42.20% 57.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0705225777 C -> T LOC_Os07g09830.1 downstream_gene_variant ; 3079.0bp to feature; MODIFIER silent_mutation Average:63.941; most accessible tissue: Callus, score: 93.46 N N N N
vg0705225777 C -> T LOC_Os07g09814.3 downstream_gene_variant ; 1996.0bp to feature; MODIFIER silent_mutation Average:63.941; most accessible tissue: Callus, score: 93.46 N N N N
vg0705225777 C -> T LOC_Os07g09814.1 intron_variant ; MODIFIER silent_mutation Average:63.941; most accessible tissue: Callus, score: 93.46 N N N N
vg0705225777 C -> T LOC_Os07g09814.2 intron_variant ; MODIFIER silent_mutation Average:63.941; most accessible tissue: Callus, score: 93.46 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0705225777 NA 1.66E-10 mr1070 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.72E-26 mr1072 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 4.02E-06 mr1088 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.75E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 4.11E-06 mr1103 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 5.73E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 8.79E-26 mr1130 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 5.23E-48 mr1152 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 9.56E-06 mr1152 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 6.87E-50 mr1154 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.46E-07 mr1213 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.91E-56 mr1861 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 7.64E-38 mr1072_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 2.46E-26 mr1074_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 2.79E-37 mr1075_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.79E-06 mr1088_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 9.57E-57 mr1124_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 5.69E-25 mr1233_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 5.07E-15 mr1333_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 9.06E-08 mr1335_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.67E-26 mr1441_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 6.25E-17 mr1592_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 3.26E-09 mr1600_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 1.90E-15 mr1686_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 2.25E-48 mr1861_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0705225777 NA 2.92E-22 mr1949_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251