\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704864945:

Variant ID: vg0704864945 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4864945
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )

Flanking Sequence (100 bp) in Reference Genome:


CTTGGGTTGGACAAGAATAAATCAAGTGTAATTTTTTTATTCCACTATGATATGTAAATTGCAATTTTGCTGCCATATGGGTCTTATTGCAAGCAATCAT[A/T]
CTGGGAATCACACGCATAGAGTAAAAAAGAATCACAAAAATTGTGCATGGGCGTCTCTCAGCAGCGTCCAGAATGGCAAAGAGGAACCAATTAATGGGTG

Reverse complement sequence

CACCCATTAATTGGTTCCTCTTTGCCATTCTGGACGCTGCTGAGAGACGCCCATGCACAATTTTTGTGATTCTTTTTTACTCTATGCGTGTGATTCCCAG[T/A]
ATGATTGCTTGCAATAAGACCCATATGGCAGCAAAATTGCAATTTACATATCATAGTGGAATAAAAAAATTACACTTGATTTATTCTTGTCCAACCCAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.00% 5.70% 0.93% 1.38% NA
All Indica  2759 88.30% 8.10% 1.34% 2.21% NA
All Japonica  1512 99.90% 0.10% 0.00% 0.00% NA
Aus  269 81.00% 14.90% 2.60% 1.49% NA
Indica I  595 91.10% 4.00% 2.35% 2.52% NA
Indica II  465 95.30% 3.90% 0.22% 0.65% NA
Indica III  913 81.40% 13.50% 1.31% 3.83% NA
Indica Intermediate  786 90.20% 7.50% 1.27% 1.02% NA
Temperate Japonica  767 99.90% 0.10% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 94.40% 5.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704864945 A -> DEL N N silent_mutation Average:51.618; most accessible tissue: Callus, score: 81.777 N N N N
vg0704864945 A -> T LOC_Os07g09280.1 downstream_gene_variant ; 616.0bp to feature; MODIFIER silent_mutation Average:51.618; most accessible tissue: Callus, score: 81.777 N N N N
vg0704864945 A -> T LOC_Os07g09290.1 downstream_gene_variant ; 91.0bp to feature; MODIFIER silent_mutation Average:51.618; most accessible tissue: Callus, score: 81.777 N N N N
vg0704864945 A -> T LOC_Os07g09280-LOC_Os07g09290 intergenic_region ; MODIFIER silent_mutation Average:51.618; most accessible tissue: Callus, score: 81.777 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704864945 6.11E-06 6.11E-06 mr1171_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 8.06E-06 8.06E-06 mr1171_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 9.12E-08 1.33E-06 mr1329_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 6.35E-07 6.35E-07 mr1329_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 4.96E-08 3.76E-07 mr1337_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 3.10E-07 3.10E-07 mr1337_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 NA 7.83E-06 mr1371_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 6.62E-07 9.33E-06 mr1524_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 3.56E-06 3.56E-06 mr1524_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 NA 8.09E-06 mr1887_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 5.27E-07 4.10E-07 mr1965_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704864945 9.55E-07 9.55E-07 mr1965_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251