\
| Variant ID: vg0704864945 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 4864945 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 245. )
CTTGGGTTGGACAAGAATAAATCAAGTGTAATTTTTTTATTCCACTATGATATGTAAATTGCAATTTTGCTGCCATATGGGTCTTATTGCAAGCAATCAT[A/T]
CTGGGAATCACACGCATAGAGTAAAAAAGAATCACAAAAATTGTGCATGGGCGTCTCTCAGCAGCGTCCAGAATGGCAAAGAGGAACCAATTAATGGGTG
CACCCATTAATTGGTTCCTCTTTGCCATTCTGGACGCTGCTGAGAGACGCCCATGCACAATTTTTGTGATTCTTTTTTACTCTATGCGTGTGATTCCCAG[T/A]
ATGATTGCTTGCAATAAGACCCATATGGCAGCAAAATTGCAATTTACATATCATAGTGGAATAAAAAAATTACACTTGATTTATTCTTGTCCAACCCAAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.00% | 5.70% | 0.93% | 1.38% | NA |
| All Indica | 2759 | 88.30% | 8.10% | 1.34% | 2.21% | NA |
| All Japonica | 1512 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Aus | 269 | 81.00% | 14.90% | 2.60% | 1.49% | NA |
| Indica I | 595 | 91.10% | 4.00% | 2.35% | 2.52% | NA |
| Indica II | 465 | 95.30% | 3.90% | 0.22% | 0.65% | NA |
| Indica III | 913 | 81.40% | 13.50% | 1.31% | 3.83% | NA |
| Indica Intermediate | 786 | 90.20% | 7.50% | 1.27% | 1.02% | NA |
| Temperate Japonica | 767 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 94.40% | 5.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0704864945 | A -> DEL | N | N | silent_mutation | Average:51.618; most accessible tissue: Callus, score: 81.777 | N | N | N | N |
| vg0704864945 | A -> T | LOC_Os07g09280.1 | downstream_gene_variant ; 616.0bp to feature; MODIFIER | silent_mutation | Average:51.618; most accessible tissue: Callus, score: 81.777 | N | N | N | N |
| vg0704864945 | A -> T | LOC_Os07g09290.1 | downstream_gene_variant ; 91.0bp to feature; MODIFIER | silent_mutation | Average:51.618; most accessible tissue: Callus, score: 81.777 | N | N | N | N |
| vg0704864945 | A -> T | LOC_Os07g09280-LOC_Os07g09290 | intergenic_region ; MODIFIER | silent_mutation | Average:51.618; most accessible tissue: Callus, score: 81.777 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0704864945 | 6.11E-06 | 6.11E-06 | mr1171_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 8.06E-06 | 8.06E-06 | mr1171_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 9.12E-08 | 1.33E-06 | mr1329_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 6.35E-07 | 6.35E-07 | mr1329_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 4.96E-08 | 3.76E-07 | mr1337_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 3.10E-07 | 3.10E-07 | mr1337_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | NA | 7.83E-06 | mr1371_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 6.62E-07 | 9.33E-06 | mr1524_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 3.56E-06 | 3.56E-06 | mr1524_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | NA | 8.09E-06 | mr1887_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 5.27E-07 | 4.10E-07 | mr1965_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0704864945 | 9.55E-07 | 9.55E-07 | mr1965_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |