Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704482336:

Variant ID: vg0704482336 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 4482336
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACCCCAACATAATTGGGGATGGGACATTATCTAGTCCAATATGTCCAGATGCATTGGACTAGGTAATGTCTGTCCAGATGCATTAGACTAGGTAATGTCC[C/T]
ATCCCCAACTATGTTGGAGTTTTTTGGACGGAGGGAAATATGTCCAGATGCATTGGACTAGGTAATGTCCCATCCCTAACTATGTTGGGGTTTTTTGAGA

Reverse complement sequence

TCTCAAAAAACCCCAACATAGTTAGGGATGGGACATTACCTAGTCCAATGCATCTGGACATATTTCCCTCCGTCCAAAAAACTCCAACATAGTTGGGGAT[G/A]
GGACATTACCTAGTCTAATGCATCTGGACAGACATTACCTAGTCCAATGCATCTGGACATATTGGACTAGATAATGTCCCATCCCCAATTATGTTGGGGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.20%	8.50%	0.28%	0.00%	NA
All Indica	2759	99.60%	0.40%	0.00%	0.00%	NA
All Japonica	1512	74.10%	25.30%	0.60%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	99.80%	0.20%	0.00%	0.00%	NA
Indica II	465	98.50%	1.50%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.50%	0.50%	0.00%	0.00%	NA
Temperate Japonica	767	96.20%	3.10%	0.65%	0.00%	NA
Tropical Japonica	504	30.80%	68.50%	0.79%	0.00%	NA
Japonica Intermediate	241	94.20%	5.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	86.70%	8.90%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0704482336	C -> T	LOC_Os07g08710.1	upstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0704482336	C -> T	LOC_Os07g08729.1	upstream_gene_variant ; 2870.0bp to feature; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0704482336	C -> T	LOC_Os07g08710.2	upstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0704482336	C -> T	LOC_Os07g08710.3	upstream_gene_variant ; 1111.0bp to feature; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0704482336	C -> T	LOC_Os07g08700.1	downstream_gene_variant ; 4318.0bp to feature; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N
vg0704482336	C -> T	LOC_Os07g08700-LOC_Os07g08710	intergenic_region ; MODIFIER	silent_mutation	Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0704482336	NA	8.63E-11	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	7.14E-07	NA	mr1083	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	1.18E-06	NA	mr1107	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	8.65E-07	NA	mr1226	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	8.42E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	1.75E-06	mr1338	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	1.41E-06	mr1405	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	8.35E-06	mr1405	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	3.74E-08	mr1408	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	4.80E-06	mr1742	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	NA	8.16E-06	mr1817	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	3.48E-06	NA	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	1.80E-09	NA	mr1082_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	1.83E-10	NA	mr1083_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	9.56E-06	NA	mr1103_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	5.67E-10	NA	mr1104_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	1.42E-13	NA	mr1107_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	1.41E-08	NA	mr1226_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336	9.49E-08	5.36E-14	mr1408_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251