\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0704482336:

Variant ID: vg0704482336 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 4482336
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACCCCAACATAATTGGGGATGGGACATTATCTAGTCCAATATGTCCAGATGCATTGGACTAGGTAATGTCTGTCCAGATGCATTAGACTAGGTAATGTCC[C/T]
ATCCCCAACTATGTTGGAGTTTTTTGGACGGAGGGAAATATGTCCAGATGCATTGGACTAGGTAATGTCCCATCCCTAACTATGTTGGGGTTTTTTGAGA

Reverse complement sequence

TCTCAAAAAACCCCAACATAGTTAGGGATGGGACATTACCTAGTCCAATGCATCTGGACATATTTCCCTCCGTCCAAAAAACTCCAACATAGTTGGGGAT[G/A]
GGACATTACCTAGTCTAATGCATCTGGACAGACATTACCTAGTCCAATGCATCTGGACATATTGGACTAGATAATGTCCCATCCCCAATTATGTTGGGGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 91.20% 8.50% 0.28% 0.00% NA
All Indica  2759 99.60% 0.40% 0.00% 0.00% NA
All Japonica  1512 74.10% 25.30% 0.60% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 98.50% 1.50% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 99.50% 0.50% 0.00% 0.00% NA
Temperate Japonica  767 96.20% 3.10% 0.65% 0.00% NA
Tropical Japonica  504 30.80% 68.50% 0.79% 0.00% NA
Japonica Intermediate  241 94.20% 5.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 86.70% 8.90% 4.44% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0704482336 C -> T LOC_Os07g08710.1 upstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0704482336 C -> T LOC_Os07g08729.1 upstream_gene_variant ; 2870.0bp to feature; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0704482336 C -> T LOC_Os07g08710.2 upstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0704482336 C -> T LOC_Os07g08710.3 upstream_gene_variant ; 1111.0bp to feature; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0704482336 C -> T LOC_Os07g08700.1 downstream_gene_variant ; 4318.0bp to feature; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N
vg0704482336 C -> T LOC_Os07g08700-LOC_Os07g08710 intergenic_region ; MODIFIER silent_mutation Average:67.64; most accessible tissue: Zhenshan97 panicle, score: 82.336 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0704482336 NA 8.63E-11 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 7.14E-07 NA mr1083 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 1.18E-06 NA mr1107 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 8.65E-07 NA mr1226 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 8.42E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 1.75E-06 mr1338 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 1.41E-06 mr1405 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 8.35E-06 mr1405 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 3.74E-08 mr1408 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 4.80E-06 mr1742 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 NA 8.16E-06 mr1817 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 3.48E-06 NA mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 1.80E-09 NA mr1082_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 1.83E-10 NA mr1083_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 9.56E-06 NA mr1103_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 5.67E-10 NA mr1104_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 1.42E-13 NA mr1107_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 1.41E-08 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0704482336 9.49E-08 5.36E-14 mr1408_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251