\
| Variant ID: vg0703940621 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 3940621 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
AATTATAAATTATTGTCACACAACGAAGTGTGTTATTTATTAGCCATTGAAAATTGCATATTCATCAAGGAAGTATGAAATTGCATATAGCTATTTAAAA[G/C]
CTATTGGTTTACTTGTAGTAAACAATATCCTAAATAATTAATGACCTTTTGGATTCAATTGATTCTGAATGATCAAATGACACCACATTTACTTTGGCGT
ACGCCAAAGTAAATGTGGTGTCATTTGATCATTCAGAATCAATTGAATCCAAAAGGTCATTAATTATTTAGGATATTGTTTACTACAAGTAAACCAATAG[C/G]
TTTTAAATAGCTATATGCAATTTCATACTTCCTTGATGAATATGCAATTTTCAATGGCTAATAAATAACACACTTCGTTGTGTGACAATAATTTATAATT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 20.00% | 4.20% | 7.93% | 67.94% | NA |
| All Indica | 2759 | 12.10% | 0.70% | 9.82% | 77.38% | NA |
| All Japonica | 1512 | 36.70% | 6.00% | 3.04% | 54.23% | NA |
| Aus | 269 | 9.30% | 1.50% | 17.47% | 71.75% | NA |
| Indica I | 595 | 9.70% | 0.00% | 5.71% | 84.54% | NA |
| Indica II | 465 | 14.20% | 0.00% | 8.39% | 77.42% | NA |
| Indica III | 913 | 11.50% | 0.10% | 12.60% | 75.79% | NA |
| Indica Intermediate | 786 | 13.40% | 2.30% | 10.56% | 73.79% | NA |
| Temperate Japonica | 767 | 56.70% | 9.50% | 3.39% | 30.38% | NA |
| Tropical Japonica | 504 | 9.70% | 0.80% | 2.58% | 86.90% | NA |
| Japonica Intermediate | 241 | 29.50% | 5.80% | 2.90% | 61.83% | NA |
| VI/Aromatic | 96 | 0.00% | 79.20% | 4.17% | 16.67% | NA |
| Intermediate | 90 | 32.20% | 7.80% | 7.78% | 52.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0703940621 | G -> DEL | N | N | silent_mutation | Average:5.66; most accessible tissue: Callus, score: 17.595 | N | N | N | N |
| vg0703940621 | G -> C | LOC_Os07g07840.1 | upstream_gene_variant ; 3761.0bp to feature; MODIFIER | silent_mutation | Average:5.66; most accessible tissue: Callus, score: 17.595 | N | N | N | N |
| vg0703940621 | G -> C | LOC_Os07g07850.1 | upstream_gene_variant ; 2403.0bp to feature; MODIFIER | silent_mutation | Average:5.66; most accessible tissue: Callus, score: 17.595 | N | N | N | N |
| vg0703940621 | G -> C | LOC_Os07g07850-LOC_Os07g07860 | intergenic_region ; MODIFIER | silent_mutation | Average:5.66; most accessible tissue: Callus, score: 17.595 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0703940621 | NA | 2.42E-17 | Awn_length | All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0703940621 | 4.11E-06 | 4.16E-07 | mr1382 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703940621 | NA | 3.17E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703940621 | NA | 1.02E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703940621 | NA | 1.83E-10 | mr1057_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703940621 | NA | 3.19E-07 | mr1465_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0703940621 | NA | 2.68E-07 | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |