\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703940621:

Variant ID: vg0703940621 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3940621
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATTATAAATTATTGTCACACAACGAAGTGTGTTATTTATTAGCCATTGAAAATTGCATATTCATCAAGGAAGTATGAAATTGCATATAGCTATTTAAAA[G/C]
CTATTGGTTTACTTGTAGTAAACAATATCCTAAATAATTAATGACCTTTTGGATTCAATTGATTCTGAATGATCAAATGACACCACATTTACTTTGGCGT

Reverse complement sequence

ACGCCAAAGTAAATGTGGTGTCATTTGATCATTCAGAATCAATTGAATCCAAAAGGTCATTAATTATTTAGGATATTGTTTACTACAAGTAAACCAATAG[C/G]
TTTTAAATAGCTATATGCAATTTCATACTTCCTTGATGAATATGCAATTTTCAATGGCTAATAAATAACACACTTCGTTGTGTGACAATAATTTATAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 20.00% 4.20% 7.93% 67.94% NA
All Indica  2759 12.10% 0.70% 9.82% 77.38% NA
All Japonica  1512 36.70% 6.00% 3.04% 54.23% NA
Aus  269 9.30% 1.50% 17.47% 71.75% NA
Indica I  595 9.70% 0.00% 5.71% 84.54% NA
Indica II  465 14.20% 0.00% 8.39% 77.42% NA
Indica III  913 11.50% 0.10% 12.60% 75.79% NA
Indica Intermediate  786 13.40% 2.30% 10.56% 73.79% NA
Temperate Japonica  767 56.70% 9.50% 3.39% 30.38% NA
Tropical Japonica  504 9.70% 0.80% 2.58% 86.90% NA
Japonica Intermediate  241 29.50% 5.80% 2.90% 61.83% NA
VI/Aromatic  96 0.00% 79.20% 4.17% 16.67% NA
Intermediate  90 32.20% 7.80% 7.78% 52.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703940621 G -> DEL N N silent_mutation Average:5.66; most accessible tissue: Callus, score: 17.595 N N N N
vg0703940621 G -> C LOC_Os07g07840.1 upstream_gene_variant ; 3761.0bp to feature; MODIFIER silent_mutation Average:5.66; most accessible tissue: Callus, score: 17.595 N N N N
vg0703940621 G -> C LOC_Os07g07850.1 upstream_gene_variant ; 2403.0bp to feature; MODIFIER silent_mutation Average:5.66; most accessible tissue: Callus, score: 17.595 N N N N
vg0703940621 G -> C LOC_Os07g07850-LOC_Os07g07860 intergenic_region ; MODIFIER silent_mutation Average:5.66; most accessible tissue: Callus, score: 17.595 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703940621 NA 2.42E-17 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0703940621 4.11E-06 4.16E-07 mr1382 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621 NA 3.17E-07 mr1382 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621 NA 1.02E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621 NA 1.83E-10 mr1057_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621 NA 3.19E-07 mr1465_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703940621 NA 2.68E-07 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251