\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703803351:

Variant ID: vg0703803351 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3803351
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.98, T: 0.02, others allele: 0.00, population size: 263. )

Flanking Sequence (100 bp) in Reference Genome:


ACGCGGTAACTTTCGGTAGACCATTTTGACGTTTCATATACAGCAATATGATTCTCAAAGAGCTGGAAACTCTGTATTTTCACACTGGAAAGAGTTTTAT[A/T]
AGTTTTTAATGCAGCTGTAGTACTAACATTGTCTTAGGGCAATGCAGCCCTAATACACAACAGACCCATTGGTAAGAGAGCAAAGTACAAGAAAATATGC

Reverse complement sequence

GCATATTTTCTTGTACTTTGCTCTCTTACCAATGGGTCTGTTGTGTATTAGGGCTGCATTGCCCTAAGACAATGTTAGTACTACAGCTGCATTAAAAACT[T/A]
ATAAAACTCTTTCCAGTGTGAAAATACAGAGTTTCCAGCTCTTTGAGAATCATATTGCTGTATATGAAACGTCAAAATGGTCTACCGAAAGTTACCGCGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 96.20% 3.80% 0.00% 0.00% NA
All Indica  2759 99.30% 0.70% 0.00% 0.00% NA
All Japonica  1512 100.00% 0.00% 0.00% 0.00% NA
Aus  269 41.30% 58.70% 0.00% 0.00% NA
Indica I  595 100.00% 0.00% 0.00% 0.00% NA
Indica II  465 99.60% 0.40% 0.00% 0.00% NA
Indica III  913 99.20% 0.80% 0.00% 0.00% NA
Indica Intermediate  786 98.70% 1.30% 0.00% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 98.90% 1.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703803351 A -> T LOC_Os07g07580.3 downstream_gene_variant ; 2508.0bp to feature; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg0703803351 A -> T LOC_Os07g07590.1 downstream_gene_variant ; 1679.0bp to feature; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg0703803351 A -> T LOC_Os07g07600.1 downstream_gene_variant ; 3333.0bp to feature; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg0703803351 A -> T LOC_Os07g07580.1 downstream_gene_variant ; 2508.0bp to feature; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg0703803351 A -> T LOC_Os07g07580.2 downstream_gene_variant ; 2508.0bp to feature; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N
vg0703803351 A -> T LOC_Os07g07580-LOC_Os07g07590 intergenic_region ; MODIFIER silent_mutation Average:67.044; most accessible tissue: Minghui63 flag leaf, score: 84.028 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0703803351 A T 0.04 0.1 0.03 0.02 0.07 0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703803351 NA 5.38E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 5.95E-06 mr1184 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 3.13E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 3.78E-06 mr1382 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 1.53E-06 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 2.58E-06 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 2.80E-12 mr1409_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 3.34E-12 mr1510_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 9.38E-32 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 2.76E-43 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 1.24E-06 mr1702_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 1.82E-06 mr1740_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703803351 NA 1.73E-09 mr1741_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251