\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703377031:

Variant ID: vg0703377031 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3377031
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAAATGAACTAAGAAGCCAAAGCTGGAGAAGCTGGGTTTTAAAGCTTTTCAGATTCTCAGAAGCTGGCTATCAAACAGCTGCTTCTCAGAATCTAAAGCT[T/C]
CCTCAAACAGGCCCTAAGTCTAGGGATGCCACAAAATTTTTGACAAATTTTTATGAGCTTTGGCTGCTTGTGTTACCTTTGTTTTTTACTCCTCAGGTTC

Reverse complement sequence

GAACCTGAGGAGTAAAAAACAAAGGTAACACAAGCAGCCAAAGCTCATAAAAATTTGTCAAAAATTTTGTGGCATCCCTAGACTTAGGGCCTGTTTGAGG[A/G]
AGCTTTAGATTCTGAGAAGCAGCTGTTTGATAGCCAGCTTCTGAGAATCTGAAAAGCTTTAAAACCCAGCTTCTCCAGCTTTGGCTTCTTAGTTCATTTT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.70% 12.10% 1.21% 0.00% NA
All Indica  2759 98.60% 1.20% 0.18% 0.00% NA
All Japonica  1512 61.60% 35.00% 3.37% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 96.80% 2.90% 0.34% 0.00% NA
Indica II  465 99.80% 0.20% 0.00% 0.00% NA
Indica III  913 99.90% 0.10% 0.00% 0.00% NA
Indica Intermediate  786 97.70% 1.90% 0.38% 0.00% NA
Temperate Japonica  767 39.20% 55.90% 4.82% 0.00% NA
Tropical Japonica  504 92.50% 6.50% 0.99% 0.00% NA
Japonica Intermediate  241 68.50% 27.80% 3.73% 0.00% NA
VI/Aromatic  96 96.90% 2.10% 1.04% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703377031 T -> C LOC_Os07g06900.1 upstream_gene_variant ; 2241.0bp to feature; MODIFIER silent_mutation Average:55.402; most accessible tissue: Callus, score: 81.165 N N N N
vg0703377031 T -> C LOC_Os07g06910.1 downstream_gene_variant ; 1078.0bp to feature; MODIFIER silent_mutation Average:55.402; most accessible tissue: Callus, score: 81.165 N N N N
vg0703377031 T -> C LOC_Os07g06920.1 downstream_gene_variant ; 3603.0bp to feature; MODIFIER silent_mutation Average:55.402; most accessible tissue: Callus, score: 81.165 N N N N
vg0703377031 T -> C LOC_Os07g06900-LOC_Os07g06910 intergenic_region ; MODIFIER silent_mutation Average:55.402; most accessible tissue: Callus, score: 81.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703377031 NA 7.76E-06 mr1164 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 1.77E-06 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 3.35E-07 mr1206 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 5.19E-07 mr1252 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 1.32E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 6.86E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 8.37E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 8.93E-07 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 6.73E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 3.41E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 8.88E-08 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 7.77E-07 mr1955 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 2.07E-06 2.07E-06 mr1955 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 5.13E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 5.59E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031 NA 4.71E-08 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251