Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703377031:

Variant ID: vg0703377031 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3377031
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAAATGAACTAAGAAGCCAAAGCTGGAGAAGCTGGGTTTTAAAGCTTTTCAGATTCTCAGAAGCTGGCTATCAAACAGCTGCTTCTCAGAATCTAAAGCT[T/C]
CCTCAAACAGGCCCTAAGTCTAGGGATGCCACAAAATTTTTGACAAATTTTTATGAGCTTTGGCTGCTTGTGTTACCTTTGTTTTTTACTCCTCAGGTTC

Reverse complement sequence

GAACCTGAGGAGTAAAAAACAAAGGTAACACAAGCAGCCAAAGCTCATAAAAATTTGTCAAAAATTTTGTGGCATCCCTAGACTTAGGGCCTGTTTGAGG[A/G]
AGCTTTAGATTCTGAGAAGCAGCTGTTTGATAGCCAGCTTCTGAGAATCTGAAAAGCTTTAAAACCCAGCTTCTCCAGCTTTGGCTTCTTAGTTCATTTT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.70%	12.10%	1.21%	0.00%	NA
All Indica	2759	98.60%	1.20%	0.18%	0.00%	NA
All Japonica	1512	61.60%	35.00%	3.37%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	96.80%	2.90%	0.34%	0.00%	NA
Indica II	465	99.80%	0.20%	0.00%	0.00%	NA
Indica III	913	99.90%	0.10%	0.00%	0.00%	NA
Indica Intermediate	786	97.70%	1.90%	0.38%	0.00%	NA
Temperate Japonica	767	39.20%	55.90%	4.82%	0.00%	NA
Tropical Japonica	504	92.50%	6.50%	0.99%	0.00%	NA
Japonica Intermediate	241	68.50%	27.80%	3.73%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	91.10%	8.90%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703377031	T -> C	LOC_Os07g06900.1	upstream_gene_variant ; 2241.0bp to feature; MODIFIER	silent_mutation	Average:55.402; most accessible tissue: Callus, score: 81.165	N	N	N	N
vg0703377031	T -> C	LOC_Os07g06910.1	downstream_gene_variant ; 1078.0bp to feature; MODIFIER	silent_mutation	Average:55.402; most accessible tissue: Callus, score: 81.165	N	N	N	N
vg0703377031	T -> C	LOC_Os07g06920.1	downstream_gene_variant ; 3603.0bp to feature; MODIFIER	silent_mutation	Average:55.402; most accessible tissue: Callus, score: 81.165	N	N	N	N
vg0703377031	T -> C	LOC_Os07g06900-LOC_Os07g06910	intergenic_region ; MODIFIER	silent_mutation	Average:55.402; most accessible tissue: Callus, score: 81.165	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703377031	NA	7.76E-06	mr1164	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	1.77E-06	mr1206	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	3.35E-07	mr1206	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	5.19E-07	mr1252	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	1.32E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	6.86E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	8.37E-06	mr1596	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	8.93E-07	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	6.73E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	3.41E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	8.88E-08	mr1880	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	7.77E-07	mr1955	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	2.07E-06	2.07E-06	mr1955	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	5.13E-08	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	5.59E-06	mr1617_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703377031	NA	4.71E-08	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251