\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703336791:

Variant ID: vg0703336791 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3336791
Reference Allele: TAlternative Allele: A
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AATGACGTCATACATTAAAATATGGAGGTAGTAATATTGAAGTTCTAGATTTTATTAGGTGTCGTAGGCCCCAAAAAAAAACATAATGTAGAATCGCCCC[T/A]
AGTTGAAATAAGACAAAAATAAGAAAAATGGGATAAGCCCAGCGGCCCTAATGGGTCATTAGAACTGAGTTCTTTTGAGAGAGTTTCCAACTAACCACTC

Reverse complement sequence

GAGTGGTTAGTTGGAAACTCTCTCAAAAGAACTCAGTTCTAATGACCCATTAGGGCCGCTGGGCTTATCCCATTTTTCTTATTTTTGTCTTATTTCAACT[A/T]
GGGGCGATTCTACATTATGTTTTTTTTTGGGGCCTACGACACCTAATAAAATCTAGAACTTCAATATTACTACCTCCATATTTTAATGTATGACGTCATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.50% 42.20% 0.08% 0.15% NA
All Indica  2759 89.30% 10.40% 0.11% 0.22% NA
All Japonica  1512 0.30% 99.70% 0.00% 0.00% NA
Aus  269 77.00% 23.00% 0.00% 0.00% NA
Indica I  595 90.30% 9.20% 0.17% 0.34% NA
Indica II  465 98.10% 1.30% 0.22% 0.43% NA
Indica III  913 84.70% 15.20% 0.00% 0.11% NA
Indica Intermediate  786 88.70% 11.10% 0.13% 0.13% NA
Temperate Japonica  767 0.10% 99.90% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 1.11% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703336791 T -> DEL N N silent_mutation Average:63.357; most accessible tissue: Callus, score: 88.67 N N N N
vg0703336791 T -> A LOC_Os07g06830.1 upstream_gene_variant ; 2516.0bp to feature; MODIFIER silent_mutation Average:63.357; most accessible tissue: Callus, score: 88.67 N N N N
vg0703336791 T -> A LOC_Os07g06834.1 upstream_gene_variant ; 2593.0bp to feature; MODIFIER silent_mutation Average:63.357; most accessible tissue: Callus, score: 88.67 N N N N
vg0703336791 T -> A LOC_Os07g06830-LOC_Os07g06834 intergenic_region ; MODIFIER silent_mutation Average:63.357; most accessible tissue: Callus, score: 88.67 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703336791 NA 7.04E-27 mr1155 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 2.06E-08 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 1.82E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 4.35E-06 3.51E-45 mr1155_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 6.16E-08 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 2.50E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 8.88E-06 mr1215_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 7.05E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 5.45E-06 mr1422_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 7.35E-06 mr1771_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791 NA 2.49E-06 mr1800_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251