Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0703336791:

Variant ID: vg0703336791 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 3336791
Reference Allele: T	Alternative Allele: A
Primary Allele: A	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AATGACGTCATACATTAAAATATGGAGGTAGTAATATTGAAGTTCTAGATTTTATTAGGTGTCGTAGGCCCCAAAAAAAAACATAATGTAGAATCGCCCC[T/A]
AGTTGAAATAAGACAAAAATAAGAAAAATGGGATAAGCCCAGCGGCCCTAATGGGTCATTAGAACTGAGTTCTTTTGAGAGAGTTTCCAACTAACCACTC

Reverse complement sequence

GAGTGGTTAGTTGGAAACTCTCTCAAAAGAACTCAGTTCTAATGACCCATTAGGGCCGCTGGGCTTATCCCATTTTTCTTATTTTTGTCTTATTTCAACT[A/T]
GGGGCGATTCTACATTATGTTTTTTTTTGGGGCCTACGACACCTAATAAAATCTAGAACTTCAATATTACTACCTCCATATTTTAATGTATGACGTCATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	57.50%	42.20%	0.08%	0.15%	NA
All Indica	2759	89.30%	10.40%	0.11%	0.22%	NA
All Japonica	1512	0.30%	99.70%	0.00%	0.00%	NA
Aus	269	77.00%	23.00%	0.00%	0.00%	NA
Indica I	595	90.30%	9.20%	0.17%	0.34%	NA
Indica II	465	98.10%	1.30%	0.22%	0.43%	NA
Indica III	913	84.70%	15.20%	0.00%	0.11%	NA
Indica Intermediate	786	88.70%	11.10%	0.13%	0.13%	NA
Temperate Japonica	767	0.10%	99.90%	0.00%	0.00%	NA
Tropical Japonica	504	0.80%	99.20%	0.00%	0.00%	NA
Japonica Intermediate	241	0.00%	100.00%	0.00%	0.00%	NA
VI/Aromatic	96	6.20%	93.80%	0.00%	0.00%	NA
Intermediate	90	42.20%	55.60%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0703336791	T -> DEL	N	N	silent_mutation	Average:63.357; most accessible tissue: Callus, score: 88.67	N	N	N	N
vg0703336791	T -> A	LOC_Os07g06830.1	upstream_gene_variant ; 2516.0bp to feature; MODIFIER	silent_mutation	Average:63.357; most accessible tissue: Callus, score: 88.67	N	N	N	N
vg0703336791	T -> A	LOC_Os07g06834.1	upstream_gene_variant ; 2593.0bp to feature; MODIFIER	silent_mutation	Average:63.357; most accessible tissue: Callus, score: 88.67	N	N	N	N
vg0703336791	T -> A	LOC_Os07g06830-LOC_Os07g06834	intergenic_region ; MODIFIER	silent_mutation	Average:63.357; most accessible tissue: Callus, score: 88.67	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0703336791	NA	7.04E-27	mr1155	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	2.06E-08	mr1155	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	1.82E-39	mr1891	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	4.35E-06	3.51E-45	mr1155_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	6.16E-08	mr1155_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	2.50E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	8.88E-06	mr1215_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	7.05E-06	mr1277_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	5.45E-06	mr1422_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	7.35E-06	mr1771_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703336791	NA	2.49E-06	mr1800_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251