\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703330513:

Variant ID: vg0703330513 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3330513
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCGTCTATAAACCGCGAGACGGATTTATTAAGCTTAATTAATCCGTCATTAGGAAATGCTTACTGTAGCATCATATTGTCAAATCATGGCGTAATTAG[G/A]
CTCAAAAGATTCGTCTCGCGATTTACATGCAAAGTGTACAATTGATTTTTTTATCCACATTTAATGCTCCATGCATATATCCAAACATTTGATGCAATGG

Reverse complement sequence

CCATTGCATCAAATGTTTGGATATATGCATGGAGCATTAAATGTGGATAAAAAAATCAATTGTACACTTTGCATGTAAATCGCGAGACGAATCTTTTGAG[C/T]
CTAATTACGCCATGATTTGACAATATGATGCTACAGTAAGCATTTCCTAATGACGGATTAATTAAGCTTAATAAATCCGTCTCGCGGTTTATAGACGAAA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.60% 42.30% 0.13% 0.00% NA
All Indica  2759 89.30% 10.50% 0.18% 0.00% NA
All Japonica  1512 0.40% 99.60% 0.00% 0.00% NA
Aus  269 76.20% 23.80% 0.00% 0.00% NA
Indica I  595 90.40% 9.20% 0.34% 0.00% NA
Indica II  465 98.10% 1.70% 0.22% 0.00% NA
Indica III  913 84.70% 15.20% 0.11% 0.00% NA
Indica Intermediate  786 88.80% 11.10% 0.13% 0.00% NA
Temperate Japonica  767 0.30% 99.70% 0.00% 0.00% NA
Tropical Japonica  504 0.80% 99.20% 0.00% 0.00% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 6.20% 93.80% 0.00% 0.00% NA
Intermediate  90 42.20% 56.70% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703330513 G -> A LOC_Os07g06820.1 downstream_gene_variant ; 558.0bp to feature; MODIFIER silent_mutation Average:66.273; most accessible tissue: Callus, score: 93.26 N N N N
vg0703330513 G -> A LOC_Os07g06830.1 downstream_gene_variant ; 2373.0bp to feature; MODIFIER silent_mutation Average:66.273; most accessible tissue: Callus, score: 93.26 N N N N
vg0703330513 G -> A LOC_Os07g06820.2 downstream_gene_variant ; 579.0bp to feature; MODIFIER silent_mutation Average:66.273; most accessible tissue: Callus, score: 93.26 N N N N
vg0703330513 G -> A LOC_Os07g06820-LOC_Os07g06830 intergenic_region ; MODIFIER silent_mutation Average:66.273; most accessible tissue: Callus, score: 93.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703330513 NA 1.68E-27 mr1155 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 2.15E-10 mr1155 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 2.93E-39 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 8.18E-45 mr1155_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 6.26E-10 mr1155_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 3.46E-06 mr1277_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703330513 NA 6.39E-07 mr1870_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251