\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703117572:

Variant ID: vg0703117572 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3117572
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GGAGTTTGGAGTTTCGTCGGTTCCGCCGGTCGGTAGGCGTGCACGTTGATCCGTCAGCTTCACCTCTTCCTGACCTGTCCGTCCCGTCCCACGCTTCTCC[A/G]
AGGGACGCTTCTCCGACTCGATCTCTTCGTCTCCTCTTTCTCAATTCGAACTGATCTCTTGCGTTTCACTGCCTCCATATAACAACGCCCATATTTGCTT

Reverse complement sequence

AAGCAAATATGGGCGTTGTTATATGGAGGCAGTGAAACGCAAGAGATCAGTTCGAATTGAGAAAGAGGAGACGAAGAGATCGAGTCGGAGAAGCGTCCCT[T/C]
GGAGAAGCGTGGGACGGGACGGACAGGTCAGGAAGAGGTGAAGCTGACGGATCAACGTGCACGCCTACCGACCGGCGGAACCGACGAAACTCCAAACTCC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 85.60% 14.10% 0.30% 0.00% NA
All Indica  2759 98.20% 1.70% 0.11% 0.00% NA
All Japonica  1512 72.80% 26.70% 0.53% 0.00% NA
Aus  269 24.90% 74.70% 0.37% 0.00% NA
Indica I  595 99.70% 0.20% 0.17% 0.00% NA
Indica II  465 98.90% 0.90% 0.22% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 96.60% 3.30% 0.13% 0.00% NA
Temperate Japonica  767 58.80% 40.30% 0.91% 0.00% NA
Tropical Japonica  504 95.40% 4.60% 0.00% 0.00% NA
Japonica Intermediate  241 69.70% 29.90% 0.41% 0.00% NA
VI/Aromatic  96 97.90% 2.10% 0.00% 0.00% NA
Intermediate  90 84.40% 13.30% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703117572 A -> G LOC_Os07g06430.1 upstream_gene_variant ; 393.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06440.1 upstream_gene_variant ; 1243.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06410.4 downstream_gene_variant ; 3624.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06420.1 downstream_gene_variant ; 1897.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06410.3 downstream_gene_variant ; 3612.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06410.1 downstream_gene_variant ; 3154.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06410.5 downstream_gene_variant ; 3154.0bp to feature; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg0703117572 A -> G LOC_Os07g06430-LOC_Os07g06440 intergenic_region ; MODIFIER silent_mutation Average:66.795; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703117572 NA 4.26E-09 mr1030 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.06E-10 mr1045 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 8.91E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.34E-08 mr1053 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 7.00E-07 mr1060 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.47E-16 mr1147 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 2.78E-07 mr1206 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 3.70E-09 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 7.69E-07 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 5.29E-06 5.29E-06 mr1357 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 9.72E-08 mr1415 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.84E-09 mr1539 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 5.88E-14 mr1540 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 9.72E-08 mr1567 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 5.99E-07 mr1568 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 2.13E-06 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.17E-07 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 5.64E-10 mr1621 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 5.25E-13 mr1732 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 3.71E-07 mr1748 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 9.68E-08 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.22E-07 mr1872 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.27E-06 mr1880 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 3.76E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.97E-06 mr1937 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 6.47E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.59E-06 mr1965 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.32E-06 mr1045_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 7.38E-06 mr1045_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 9.26E-06 mr1072_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.08E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 4.22E-08 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703117572 NA 1.56E-08 mr1805_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251