\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0703027716:

Variant ID: vg0703027716 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 3027716
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCTTCCTCCTCGAATCCGTGTCCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACGGTATCCGGAGACACCGTAGGGGAATAGCCATGCCTATCCC[T/C]
AAAGTCGATATCCGGCGGCTTGTCTTGGCATATGTTGGCTTGTATGTTGTGGCTTCTGTTATTCCGTATATTGTGGTGGTTGTTGATTGAGGTGGTCGTC

Reverse complement sequence

GACGACCACCTCAATCAACAACCACCACAATATACGGAATAACAGAAGCCACAACATACAAGCCAACATATGCCAAGACAAGCCGCCGGATATCGACTTT[A/G]
GGGATAGGCATGGCTATTCCCCTACGGTGTCTCCGGATACCGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGGACACGGATTCGAGGAGGAAGG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.20% 4.90% 0.91% 6.01% NA
All Indica  2759 88.50% 1.40% 1.41% 8.70% NA
All Japonica  1512 97.40% 0.00% 0.07% 2.51% NA
Aus  269 27.90% 71.00% 1.12% 0.00% NA
Indica I  595 85.70% 0.20% 2.86% 11.26% NA
Indica II  465 80.40% 0.20% 1.72% 17.63% NA
Indica III  913 97.00% 2.00% 0.33% 0.66% NA
Indica Intermediate  786 85.50% 2.30% 1.40% 10.81% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 92.90% 0.00% 0.20% 6.94% NA
Japonica Intermediate  241 98.80% 0.00% 0.00% 1.24% NA
VI/Aromatic  96 96.90% 1.00% 0.00% 2.08% NA
Intermediate  90 92.20% 3.30% 0.00% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0703027716 T -> DEL LOC_Os07g06210.1 N frameshift_variant Average:16.383; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 N N N N
vg0703027716 T -> C LOC_Os07g06210.1 missense_variant ; p.Arg46Gly; MODERATE nonsynonymous_codon ; R46G Average:16.383; most accessible tissue: Zhenshan97 flag leaf, score: 38.066 benign 1.18 DELETERIOUS 0.03

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0703027716 NA 3.88E-08 mr1004 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.34E-07 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.53E-06 mr1007 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.52E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.01E-07 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.49E-07 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.06E-08 mr1230 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 2.76E-06 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.73E-06 mr1286 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 2.74E-06 mr1319 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 2.91E-08 mr1321 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 4.79E-08 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.22E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 8.96E-06 mr1400 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 2.39E-06 mr1424 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 5.12E-06 mr1432 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.69E-08 mr1438 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.91E-06 mr1444 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 5.10E-10 mr1499 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.71E-06 mr1512 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 8.90E-07 mr1556 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 7.72E-07 mr1596 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 3.45E-06 mr1621 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.48E-07 mr1665 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 7.09E-10 mr1730 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 2.03E-06 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.29E-07 mr1884 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.47E-09 mr1939 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 7.99E-06 mr1948 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0703027716 NA 1.89E-06 mr1815_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251