Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702783022:

Variant ID: vg0702783022 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2783022
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAGACCATAGTTGGCACTCTAACAATAGTCAATTAAATTTAATTGTTGATCTGATATATAATTTTTATATAAATTGGGATAAAAAGCAGGAAGATTTA[A/G]
AGCGAAGGATTGAAGATTTGTTTAAAGAACGAAAGCAATCTGAAGAACAATATTTGCTTGTCAGTAATAAATTAAATTCAGTGCTAAAAGAGCTAGAGGA

Reverse complement sequence

TCCTCTAGCTCTTTTAGCACTGAATTTAATTTATTACTGACAAGCAAATATTGTTCTTCAGATTGCTTTCGTTCTTTAAACAAATCTTCAATCCTTCGCT[T/C]
TAAATCTTCCTGCTTTTTATCCCAATTTATATAAAAATTATATATCAGATCAACAATTAAATTTAATTGACTATTGTTAGAGTGCCAACTATGGTCTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	84.60%	15.10%	0.36%	0.00%	NA
All Indica	2759	97.70%	2.20%	0.11%	0.00%	NA
All Japonica	1512	56.80%	42.30%	0.93%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	92.90%	7.10%	0.00%	0.00%	NA
Indica II	465	99.60%	0.20%	0.22%	0.00%	NA
Indica III	913	99.80%	0.20%	0.00%	0.00%	NA
Indica Intermediate	786	97.80%	1.90%	0.25%	0.00%	NA
Temperate Japonica	767	32.70%	65.70%	1.56%	0.00%	NA
Tropical Japonica	504	91.50%	8.30%	0.20%	0.00%	NA
Japonica Intermediate	241	61.00%	38.60%	0.41%	0.00%	NA
VI/Aromatic	96	96.90%	3.10%	0.00%	0.00%	NA
Intermediate	90	87.80%	12.20%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702783022	A -> G	LOC_Os07g05770.1	upstream_gene_variant ; 1810.0bp to feature; MODIFIER	silent_mutation	Average:12.813; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0702783022	A -> G	LOC_Os07g05780.1	upstream_gene_variant ; 245.0bp to feature; MODIFIER	silent_mutation	Average:12.813; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0702783022	A -> G	LOC_Os07g05790.1	upstream_gene_variant ; 3560.0bp to feature; MODIFIER	silent_mutation	Average:12.813; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N
vg0702783022	A -> G	LOC_Os07g05770-LOC_Os07g05780	intergenic_region ; MODIFIER	silent_mutation	Average:12.813; most accessible tissue: Minghui63 root, score: 17.665	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702783022	5.29E-07	NA	mr1115	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	2.35E-06	NA	mr1137	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	3.45E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	2.84E-06	mr1229	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	1.98E-06	mr1521	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	8.72E-06	mr1596	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	3.58E-06	NA	mr1611	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	8.39E-06	NA	mr1617	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	1.16E-07	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	6.51E-07	mr1763	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	3.32E-07	NA	mr1137_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	1.19E-09	mr1137_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022	NA	6.74E-07	mr1880_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251