\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702783022:

Variant ID: vg0702783022 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2783022
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TGAAGACCATAGTTGGCACTCTAACAATAGTCAATTAAATTTAATTGTTGATCTGATATATAATTTTTATATAAATTGGGATAAAAAGCAGGAAGATTTA[A/G]
AGCGAAGGATTGAAGATTTGTTTAAAGAACGAAAGCAATCTGAAGAACAATATTTGCTTGTCAGTAATAAATTAAATTCAGTGCTAAAAGAGCTAGAGGA

Reverse complement sequence

TCCTCTAGCTCTTTTAGCACTGAATTTAATTTATTACTGACAAGCAAATATTGTTCTTCAGATTGCTTTCGTTCTTTAAACAAATCTTCAATCCTTCGCT[T/C]
TAAATCTTCCTGCTTTTTATCCCAATTTATATAAAAATTATATATCAGATCAACAATTAAATTTAATTGACTATTGTTAGAGTGCCAACTATGGTCTTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 84.60% 15.10% 0.36% 0.00% NA
All Indica  2759 97.70% 2.20% 0.11% 0.00% NA
All Japonica  1512 56.80% 42.30% 0.93% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 92.90% 7.10% 0.00% 0.00% NA
Indica II  465 99.60% 0.20% 0.22% 0.00% NA
Indica III  913 99.80% 0.20% 0.00% 0.00% NA
Indica Intermediate  786 97.80% 1.90% 0.25% 0.00% NA
Temperate Japonica  767 32.70% 65.70% 1.56% 0.00% NA
Tropical Japonica  504 91.50% 8.30% 0.20% 0.00% NA
Japonica Intermediate  241 61.00% 38.60% 0.41% 0.00% NA
VI/Aromatic  96 96.90% 3.10% 0.00% 0.00% NA
Intermediate  90 87.80% 12.20% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702783022 A -> G LOC_Os07g05770.1 upstream_gene_variant ; 1810.0bp to feature; MODIFIER silent_mutation Average:12.813; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0702783022 A -> G LOC_Os07g05780.1 upstream_gene_variant ; 245.0bp to feature; MODIFIER silent_mutation Average:12.813; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0702783022 A -> G LOC_Os07g05790.1 upstream_gene_variant ; 3560.0bp to feature; MODIFIER silent_mutation Average:12.813; most accessible tissue: Minghui63 root, score: 17.665 N N N N
vg0702783022 A -> G LOC_Os07g05770-LOC_Os07g05780 intergenic_region ; MODIFIER silent_mutation Average:12.813; most accessible tissue: Minghui63 root, score: 17.665 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702783022 5.29E-07 NA mr1115 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 2.35E-06 NA mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 3.45E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 2.84E-06 mr1229 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 1.98E-06 mr1521 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 8.72E-06 mr1596 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 3.58E-06 NA mr1611 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 8.39E-06 NA mr1617 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 1.16E-07 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 6.51E-07 mr1763 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 3.32E-07 NA mr1137_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 1.19E-09 mr1137_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702783022 NA 6.74E-07 mr1880_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251