| Variant ID: vg0702642154 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 2642154 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 92. )
GCACGGCTAGTCCCCTACGGTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGAGCACAAACTCGAGGAGGAAGACTACCCT[A/G]
TTGTCGACTATGAGTCAGACCTTCAAACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTATGATTATGGTGAATAAGAGCAAT
ATTGCTCTTATTCACCATAATCATACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTTTGAAGGTCTGACTCATAGTCGACAA[T/C]
AGGGTAGTCTTCCTCCTCGAGTTTGTGCTCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAGTATCCGGAGACACCGTAGGGGACTAGCCGTGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.00% | 0.34% | 0.15% | NA |
| All Indica | 2759 | 91.40% | 8.00% | 0.36% | 0.22% | NA |
| All Japonica | 1512 | 0.70% | 99.10% | 0.20% | 0.00% | NA |
| Aus | 269 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica I | 595 | 79.80% | 19.80% | 0.17% | 0.17% | NA |
| Indica II | 465 | 95.70% | 3.40% | 0.86% | 0.00% | NA |
| Indica III | 913 | 96.70% | 3.00% | 0.22% | 0.11% | NA |
| Indica Intermediate | 786 | 91.30% | 7.80% | 0.38% | 0.51% | NA |
| Temperate Japonica | 767 | 0.00% | 100.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 2.00% | 97.60% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 0.00% | 99.60% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 27.10% | 72.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 43.30% | 52.20% | 3.33% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0702642154 | A -> DEL | N | N | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05610.1 | upstream_gene_variant ; 1664.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05610.2 | upstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05610.3 | upstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05610.4 | upstream_gene_variant ; 1665.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05620.1 | downstream_gene_variant ; 1386.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05620.2 | downstream_gene_variant ; 1386.0bp to feature; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| vg0702642154 | A -> G | LOC_Os07g05610-LOC_Os07g05620 | intergenic_region ; MODIFIER | silent_mutation | Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0702642154 | NA | 1.50E-09 | mr1336 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | NA | 1.32E-36 | mr1542 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | NA | 4.57E-13 | mr1701 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | NA | 1.59E-13 | mr1128_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | NA | 1.56E-14 | mr1579_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | NA | 2.21E-15 | mr1767_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0702642154 | 2.23E-07 | 4.70E-10 | mr1959_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |