Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0702642154:

Variant ID: vg0702642154 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 2642154
Reference Allele: A	Alternative Allele: G
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:

GCACGGCTAGTCCCCTACGGTGTCTCCGGATACTGTCAGGAGAGACGAAAGCGCTATCTCTGATCTCGCCGAGCACAAACTCGAGGAGGAAGACTACCCT[A/G]
TTGTCGACTATGAGTCAGACCTTCAAACCGCCATGTCGACAACAGTTAGATAGGCTACCCCAAATATTGTACTGGTATGATTATGGTGAATAAGAGCAAT

Reverse complement sequence

ATTGCTCTTATTCACCATAATCATACCAGTACAATATTTGGGGTAGCCTATCTAACTGTTGTCGACATGGCGGTTTGAAGGTCTGACTCATAGTCGACAA[T/C]
AGGGTAGTCTTCCTCCTCGAGTTTGTGCTCGGCGAGATCAGAGATAGCGCTTTCGTCTCTCCTGACAGTATCCGGAGACACCGTAGGGGACTAGCCGTGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.50%	39.00%	0.34%	0.15%	NA
All Indica	2759	91.40%	8.00%	0.36%	0.22%	NA
All Japonica	1512	0.70%	99.10%	0.20%	0.00%	NA
Aus	269	98.50%	1.50%	0.00%	0.00%	NA
Indica I	595	79.80%	19.80%	0.17%	0.17%	NA
Indica II	465	95.70%	3.40%	0.86%	0.00%	NA
Indica III	913	96.70%	3.00%	0.22%	0.11%	NA
Indica Intermediate	786	91.30%	7.80%	0.38%	0.51%	NA
Temperate Japonica	767	0.00%	100.00%	0.00%	0.00%	NA
Tropical Japonica	504	2.00%	97.60%	0.40%	0.00%	NA
Japonica Intermediate	241	0.00%	99.60%	0.41%	0.00%	NA
VI/Aromatic	96	27.10%	72.90%	0.00%	0.00%	NA
Intermediate	90	43.30%	52.20%	3.33%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0702642154	A -> DEL	N	N	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05610.1	upstream_gene_variant ; 1664.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05610.2	upstream_gene_variant ; 1665.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05610.3	upstream_gene_variant ; 1665.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05610.4	upstream_gene_variant ; 1665.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05620.1	downstream_gene_variant ; 1386.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05620.2	downstream_gene_variant ; 1386.0bp to feature; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N
vg0702642154	A -> G	LOC_Os07g05610-LOC_Os07g05620	intergenic_region ; MODIFIER	silent_mutation	Average:62.828; most accessible tissue: Minghui63 panicle, score: 81.412	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0702642154	NA	1.50E-09	mr1336	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	NA	1.32E-36	mr1542	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	NA	4.57E-13	mr1701	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	NA	1.59E-13	mr1128_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	NA	1.56E-14	mr1579_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	NA	2.21E-15	mr1767_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702642154	2.23E-07	4.70E-10	mr1959_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251