\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0702447742:

Variant ID: vg0702447742 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 2447742
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.87, A: 0.13, others allele: 0.00, population size: 46. )

Flanking Sequence (100 bp) in Reference Genome:


CTGCAAGGAGATTTGAAGAAAGTCTCCATACTCCAACTTGCCTTGAACATGCAAGAATTAGGATAACGGCGACTGAACCCCTGTCTTGTAACGATTTGGC[G/A]
GAGGTACGCAACACCGGAGATTGAAGGGATAATGTTGCCGTAGAGAGCTTCAATAAGCAACCAACAAGCTTGCCACCAAGAGCTTCAGCAGAAGCATGTG

Reverse complement sequence

CACATGCTTCTGCTGAAGCTCTTGGTGGCAAGCTTGTTGGTTGCTTATTGAAGCTCTCTACGGCAACATTATCCCTTCAATCTCCGGTGTTGCGTACCTC[C/T]
GCCAAATCGTTACAAGACAGGGGTTCAGTCGCCGTTATCCTAATTCTTGCATGTTCAAGGCAAGTTGGAGTATGGAGACTTTCTTCAAATCTCCTTGCAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 42.70% 37.20% 11.98% 8.17% NA
All Indica  2759 61.70% 5.00% 19.86% 13.48% NA
All Japonica  1512 0.60% 99.10% 0.20% 0.13% NA
Aus  269 94.80% 1.50% 2.23% 1.49% NA
Indica I  595 43.70% 14.80% 33.45% 8.07% NA
Indica II  465 60.00% 3.40% 21.72% 14.84% NA
Indica III  913 74.20% 0.30% 7.89% 17.63% NA
Indica Intermediate  786 61.80% 3.80% 22.39% 11.96% NA
Temperate Japonica  767 0.00% 99.90% 0.13% 0.00% NA
Tropical Japonica  504 1.80% 97.40% 0.40% 0.40% NA
Japonica Intermediate  241 0.00% 100.00% 0.00% 0.00% NA
VI/Aromatic  96 21.90% 72.90% 0.00% 5.21% NA
Intermediate  90 32.20% 54.40% 10.00% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0702447742 G -> DEL N N silent_mutation Average:36.914; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0702447742 G -> A LOC_Os07g05350.1 downstream_gene_variant ; 136.0bp to feature; MODIFIER silent_mutation Average:36.914; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N
vg0702447742 G -> A LOC_Os07g05330-LOC_Os07g05350 intergenic_region ; MODIFIER silent_mutation Average:36.914; most accessible tissue: Zhenshan97 panicle, score: 71.253 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0702447742 NA 2.54E-25 mr1024 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 1.28E-07 mr1162 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 5.05E-12 mr1281 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 2.77E-88 mr1517 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 8.24E-20 mr1541 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 7.42E-40 mr1542 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 4.75E-45 mr1563 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 2.85E-17 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 5.20E-57 mr1594 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 1.84E-08 mr1595 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 6.26E-11 mr1630 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 2.03E-31 mr1647 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 4.37E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 3.49E-12 mr1713 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 5.74E-35 mr1733 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 2.64E-06 mr1733 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 3.28E-87 mr1758 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 2.40E-07 mr1785 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 1.40E-52 mr1795 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 1.21E-06 1.62E-09 mr1804 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 8.57E-08 mr1804 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 1.20E-13 mr1874 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 1.38E-38 mr1891 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0702447742 NA 9.59E-19 mr1281_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251