\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701536026:

Variant ID: vg0701536026 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1536026
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:


AATCTATTTATTTTGGGTTTTAAATCCTTCGCACTAATGCTATGTTGAATTATGGATAACAAAGTTTTGTGATTAAATTTATATTAACCATGTAGTTTGC[G/A]
ATAACTTTGTTAGTAAATCTATAAAACATTTCATCTTAAACATGTAATTTTGTGATAAATTTAGTGTTAAATCTTTAGTTTTATAATATATCGTAATTTG

Reverse complement sequence

CAAATTACGATATATTATAAAACTAAAGATTTAACACTAAATTTATCACAAAATTACATGTTTAAGATGAAATGTTTTATAGATTTACTAACAAAGTTAT[C/T]
GCAAACTACATGGTTAATATAAATTTAATCACAAAACTTTGTTATCCATAATTCAACATAGCATTAGTGCGAAGGATTTAAAACCCAAAATAAATAGATT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 55.30% 40.70% 0.06% 3.94% NA
All Indica  2759 84.70% 14.70% 0.00% 0.62% NA
All Japonica  1512 3.20% 96.20% 0.00% 0.60% NA
Aus  269 36.10% 4.50% 0.37% 59.11% NA
Indica I  595 94.10% 5.90% 0.00% 0.00% NA
Indica II  465 44.90% 54.80% 0.00% 0.22% NA
Indica III  913 98.90% 0.70% 0.00% 0.44% NA
Indica Intermediate  786 84.60% 13.90% 0.00% 1.53% NA
Temperate Japonica  767 0.90% 99.10% 0.00% 0.00% NA
Tropical Japonica  504 6.50% 93.50% 0.00% 0.00% NA
Japonica Intermediate  241 3.30% 92.90% 0.00% 3.73% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 45.60% 51.10% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701536026 G -> DEL N N silent_mutation Average:29.211; most accessible tissue: Callus, score: 67.49 N N N N
vg0701536026 G -> A LOC_Os07g03750.1 upstream_gene_variant ; 3454.0bp to feature; MODIFIER silent_mutation Average:29.211; most accessible tissue: Callus, score: 67.49 N N N N
vg0701536026 G -> A LOC_Os07g03740.1 intron_variant ; MODIFIER silent_mutation Average:29.211; most accessible tissue: Callus, score: 67.49 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701536026 NA 4.47E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 1.87E-15 mr1143 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 9.54E-16 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 2.32E-14 mr1969 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 2.35E-17 mr1995 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 2.60E-06 mr1042_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 2.73E-09 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 1.62E-14 mr1133_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 1.73E-07 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 2.70E-23 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 3.79E-07 mr1167_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 1.45E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 3.62E-06 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 9.78E-09 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 5.65E-09 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 5.46E-09 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 6.92E-11 mr1667_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 3.03E-06 mr1677_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 1.09E-17 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 7.65E-06 mr1726_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 4.84E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 8.29E-08 mr1889_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 6.84E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 9.59E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026 NA 3.12E-18 mr1950_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251