Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701536026:

Variant ID: vg0701536026 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1536026
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.83, A: 0.17, others allele: 0.00, population size: 69. )

Flanking Sequence (100 bp) in Reference Genome:

AATCTATTTATTTTGGGTTTTAAATCCTTCGCACTAATGCTATGTTGAATTATGGATAACAAAGTTTTGTGATTAAATTTATATTAACCATGTAGTTTGC[G/A]
ATAACTTTGTTAGTAAATCTATAAAACATTTCATCTTAAACATGTAATTTTGTGATAAATTTAGTGTTAAATCTTTAGTTTTATAATATATCGTAATTTG

Reverse complement sequence

CAAATTACGATATATTATAAAACTAAAGATTTAACACTAAATTTATCACAAAATTACATGTTTAAGATGAAATGTTTTATAGATTTACTAACAAAGTTAT[C/T]
GCAAACTACATGGTTAATATAAATTTAATCACAAAACTTTGTTATCCATAATTCAACATAGCATTAGTGCGAAGGATTTAAAACCCAAAATAAATAGATT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	55.30%	40.70%	0.06%	3.94%	NA
All Indica	2759	84.70%	14.70%	0.00%	0.62%	NA
All Japonica	1512	3.20%	96.20%	0.00%	0.60%	NA
Aus	269	36.10%	4.50%	0.37%	59.11%	NA
Indica I	595	94.10%	5.90%	0.00%	0.00%	NA
Indica II	465	44.90%	54.80%	0.00%	0.22%	NA
Indica III	913	98.90%	0.70%	0.00%	0.44%	NA
Indica Intermediate	786	84.60%	13.90%	0.00%	1.53%	NA
Temperate Japonica	767	0.90%	99.10%	0.00%	0.00%	NA
Tropical Japonica	504	6.50%	93.50%	0.00%	0.00%	NA
Japonica Intermediate	241	3.30%	92.90%	0.00%	3.73%	NA
VI/Aromatic	96	92.70%	7.30%	0.00%	0.00%	NA
Intermediate	90	45.60%	51.10%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701536026	G -> DEL	N	N	silent_mutation	Average:29.211; most accessible tissue: Callus, score: 67.49	N	N	N	N
vg0701536026	G -> A	LOC_Os07g03750.1	upstream_gene_variant ; 3454.0bp to feature; MODIFIER	silent_mutation	Average:29.211; most accessible tissue: Callus, score: 67.49	N	N	N	N
vg0701536026	G -> A	LOC_Os07g03740.1	intron_variant ; MODIFIER	silent_mutation	Average:29.211; most accessible tissue: Callus, score: 67.49	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701536026	NA	4.47E-10	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	1.87E-15	mr1143	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	9.54E-16	mr1167	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	2.32E-14	mr1969	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	2.35E-17	mr1995	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	2.60E-06	mr1042_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	2.73E-09	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	1.62E-14	mr1133_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	1.73E-07	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	2.70E-23	mr1167_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	3.79E-07	mr1167_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	1.45E-06	mr1269_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	3.62E-06	mr1355_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	9.78E-09	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	5.65E-09	mr1478_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	5.46E-09	mr1479_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	6.92E-11	mr1667_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	3.03E-06	mr1677_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	1.09E-17	mr1726_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	7.65E-06	mr1726_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	4.84E-06	mr1786_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	8.29E-08	mr1889_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	6.84E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	9.59E-10	mr1940_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701536026	NA	3.12E-18	mr1950_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251