\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701450700:

Variant ID: vg0701450700 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1450700
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.96, A: 0.04, others allele: 0.00, population size: 191. )

Flanking Sequence (100 bp) in Reference Genome:


AAACAAAAAAGACAAATTTAGATATAAACAGTATGCTACTATTCATACGCTGAATTTGAATTTTTTTATATCTCGACGTGTGAGTTAAGTTTGCACTTAA[G/A]
ATTTTGTGTAGTTGTCTATATGTGTTGTATGAATGTTGTCAAATTTTTTCAGAATTTTTCATAACCGTTTAGATGGTTTTTAAGCAAATGAGGAACATCC

Reverse complement sequence

GGATGTTCCTCATTTGCTTAAAAACCATCTAAACGGTTATGAAAAATTCTGAAAAAATTTGACAACATTCATACAACACATATAGACAACTACACAAAAT[C/T]
TTAAGTGCAAACTTAACTCACACGTCGAGATATAAAAAAATTCAAATTCAGCGTATGAATAGTAGCATACTGTTTATATCTAAATTTGTCTTTTTTGTTT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.20% 38.70% 0.32% 2.86% NA
All Indica  2759 37.40% 62.10% 0.40% 0.11% NA
All Japonica  1512 96.90% 2.60% 0.13% 0.40% NA
Aus  269 65.80% 14.90% 0.37% 18.96% NA
Indica I  595 7.20% 92.80% 0.00% 0.00% NA
Indica II  465 85.60% 14.20% 0.22% 0.00% NA
Indica III  913 28.60% 71.10% 0.33% 0.00% NA
Indica Intermediate  786 42.10% 56.60% 0.89% 0.38% NA
Temperate Japonica  767 99.10% 0.80% 0.00% 0.13% NA
Tropical Japonica  504 93.30% 6.30% 0.00% 0.40% NA
Japonica Intermediate  241 97.50% 0.40% 0.83% 1.24% NA
VI/Aromatic  96 18.80% 8.30% 1.04% 71.88% NA
Intermediate  90 62.20% 31.10% 0.00% 6.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701450700 G -> DEL N N silent_mutation Average:35.38; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0701450700 G -> A LOC_Os07g03620.1 upstream_gene_variant ; 1256.0bp to feature; MODIFIER silent_mutation Average:35.38; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0701450700 G -> A LOC_Os07g03610.1 downstream_gene_variant ; 959.0bp to feature; MODIFIER silent_mutation Average:35.38; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N
vg0701450700 G -> A LOC_Os07g03610-LOC_Os07g03620 intergenic_region ; MODIFIER silent_mutation Average:35.38; most accessible tissue: Zhenshan97 panicle, score: 57.341 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701450700 NA 2.22E-13 Grain_length Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701450700 NA 9.51E-11 Grain_width Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0701450700 NA 3.49E-09 mr1399 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 5.61E-07 mr1399 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 4.30E-06 mr1479 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 3.46E-06 mr1502 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 8.09E-08 mr1542 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 3.63E-06 mr1543 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 1.83E-06 mr1598 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 9.22E-07 mr1919 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 9.21E-07 mr1272_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 4.24E-06 mr1291_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 3.49E-06 mr1332_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 6.99E-08 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 2.58E-06 mr1355_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 9.83E-10 mr1360_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 4.95E-07 mr1458_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 1.92E-08 mr1478_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 1.04E-08 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 5.94E-06 mr1479_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 7.21E-06 mr1502_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 2.26E-06 mr1542_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 6.81E-08 mr1607_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 8.65E-06 mr1655_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 2.82E-06 mr1662_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 1.17E-06 mr1679_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 7.39E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 4.79E-06 mr1720_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 7.35E-10 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 5.11E-07 mr1892_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 8.34E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 4.95E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 1.39E-14 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701450700 NA 3.19E-08 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251