Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0701436306:

Variant ID: vg0701436306 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1436306
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:

AATATGTGCAACACTAAATTAATTAGTTTTATTAAATTGATAATTAAATTTATTTTCATAATATATTTGTATTGGGTTGAAAATATTACTATTTTATTCA[T/C]
AAACTTAGTTAAACTTGAAGCAAATGACTTATAATCTGAAACAGAGGCACTAACAAGTTTTGCCACATTATCCACTTTGTTTCCCATGAGTGCTTTGTTC

Reverse complement sequence

GAACAAAGCACTCATGGGAAACAAAGTGGATAATGTGGCAAAACTTGTTAGTGCCTCTGTTTCAGATTATAAGTCATTTGCTTCAAGTTTAACTAAGTTT[A/G]
TGAATAAAATAGTAATATTTTCAACCCAATACAAATATATTATGAAAATAAATTTAATTATCAATTTAATAAAACTAATTAATTTAGTGTTGCACATATT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	10.00%	1.31%	4.89%	NA
All Indica	2759	80.10%	10.40%	1.30%	8.19%	NA
All Japonica	1512	87.00%	11.40%	1.59%	0.07%	NA
Aus	269	99.60%	0.00%	0.37%	0.00%	NA
Indica I	595	88.60%	0.20%	1.01%	10.25%	NA
Indica II	465	48.40%	47.50%	3.23%	0.86%	NA
Indica III	913	89.20%	0.00%	0.22%	10.62%	NA
Indica Intermediate	786	81.80%	8.40%	1.65%	8.14%	NA
Temperate Japonica	767	98.70%	0.40%	0.91%	0.00%	NA
Tropical Japonica	504	66.50%	31.20%	2.18%	0.20%	NA
Japonica Intermediate	241	92.50%	5.00%	2.49%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	81.10%	13.30%	1.11%	4.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701436306	T -> DEL	N	N	silent_mutation	Average:47.779; most accessible tissue: Minghui63 root, score: 80.76	N	N	N	N
vg0701436306	T -> C	LOC_Os07g03590.1	upstream_gene_variant ; 986.0bp to feature; MODIFIER	silent_mutation	Average:47.779; most accessible tissue: Minghui63 root, score: 80.76	N	N	N	N
vg0701436306	T -> C	LOC_Os07g03288.1	upstream_gene_variant ; 1118.0bp to feature; MODIFIER	silent_mutation	Average:47.779; most accessible tissue: Minghui63 root, score: 80.76	N	N	N	N
vg0701436306	T -> C	LOC_Os07g03580.1	downstream_gene_variant ; 2899.0bp to feature; MODIFIER	silent_mutation	Average:47.779; most accessible tissue: Minghui63 root, score: 80.76	N	N	N	N
vg0701436306	T -> C	LOC_Os07g03580-LOC_Os07g03590	intergenic_region ; MODIFIER	silent_mutation	Average:47.779; most accessible tissue: Minghui63 root, score: 80.76	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701436306	NA	9.78E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	5.60E-10	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	2.29E-07	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	4.41E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	1.69E-06	NA	mr1085_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	4.64E-07	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	1.32E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	1.76E-10	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	4.47E-14	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306	NA	4.78E-11	mr1850_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251