\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701436306:

Variant ID: vg0701436306 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1436306
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, others allele: 0.00, population size: 126. )

Flanking Sequence (100 bp) in Reference Genome:


AATATGTGCAACACTAAATTAATTAGTTTTATTAAATTGATAATTAAATTTATTTTCATAATATATTTGTATTGGGTTGAAAATATTACTATTTTATTCA[T/C]
AAACTTAGTTAAACTTGAAGCAAATGACTTATAATCTGAAACAGAGGCACTAACAAGTTTTGCCACATTATCCACTTTGTTTCCCATGAGTGCTTTGTTC

Reverse complement sequence

GAACAAAGCACTCATGGGAAACAAAGTGGATAATGTGGCAAAACTTGTTAGTGCCTCTGTTTCAGATTATAAGTCATTTGCTTCAAGTTTAACTAAGTTT[A/G]
TGAATAAAATAGTAATATTTTCAACCCAATACAAATATATTATGAAAATAAATTTAATTATCAATTTAATAAAACTAATTAATTTAGTGTTGCACATATT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.80% 10.00% 1.31% 4.89% NA
All Indica  2759 80.10% 10.40% 1.30% 8.19% NA
All Japonica  1512 87.00% 11.40% 1.59% 0.07% NA
Aus  269 99.60% 0.00% 0.37% 0.00% NA
Indica I  595 88.60% 0.20% 1.01% 10.25% NA
Indica II  465 48.40% 47.50% 3.23% 0.86% NA
Indica III  913 89.20% 0.00% 0.22% 10.62% NA
Indica Intermediate  786 81.80% 8.40% 1.65% 8.14% NA
Temperate Japonica  767 98.70% 0.40% 0.91% 0.00% NA
Tropical Japonica  504 66.50% 31.20% 2.18% 0.20% NA
Japonica Intermediate  241 92.50% 5.00% 2.49% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 81.10% 13.30% 1.11% 4.44% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701436306 T -> DEL N N silent_mutation Average:47.779; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg0701436306 T -> C LOC_Os07g03590.1 upstream_gene_variant ; 986.0bp to feature; MODIFIER silent_mutation Average:47.779; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg0701436306 T -> C LOC_Os07g03288.1 upstream_gene_variant ; 1118.0bp to feature; MODIFIER silent_mutation Average:47.779; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg0701436306 T -> C LOC_Os07g03580.1 downstream_gene_variant ; 2899.0bp to feature; MODIFIER silent_mutation Average:47.779; most accessible tissue: Minghui63 root, score: 80.76 N N N N
vg0701436306 T -> C LOC_Os07g03580-LOC_Os07g03590 intergenic_region ; MODIFIER silent_mutation Average:47.779; most accessible tissue: Minghui63 root, score: 80.76 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701436306 NA 9.78E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 5.60E-10 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 2.29E-07 mr1877 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 4.41E-06 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 1.69E-06 NA mr1085_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 4.64E-07 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 1.32E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 1.76E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 4.47E-14 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701436306 NA 4.78E-11 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251