\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701246321:

Variant ID: vg0701246321 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1246321
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.93, C: 0.08, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


TGGGGGAGAGAGAGAGAGAGGAGGGAAGAGGAAGACTTTGGGGAAAGCGAAGTTTGACGAGGAGATGAGCTGAGACGAGGGGCGGTGGTGCAAGTGGTGT[T/C]
GCTGCGTGGCGAATCGATGTGGTTGAGCTGCCTGTCAGTCACTGAGAGCAGGGATAATAATAGGACTCACTTCTTACTATTAATTAATCTTAAAGCCAAC

Reverse complement sequence

GTTGGCTTTAAGATTAATTAATAGTAAGAAGTGAGTCCTATTATTATCCCTGCTCTCAGTGACTGACAGGCAGCTCAACCACATCGATTCGCCACGCAGC[A/G]
ACACCACTTGCACCACCGCCCCTCGTCTCAGCTCATCTCCTCGTCAAACTTCGCTTTCCCCAAAGTCTTCCTCTTCCCTCCTCTCTCTCTCTCTCCCCCA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.90% 45.80% 0.38% 0.00% NA
All Indica  2759 82.00% 17.50% 0.47% 0.00% NA
All Japonica  1512 3.40% 96.40% 0.20% 0.00% NA
Aus  269 40.50% 59.50% 0.00% 0.00% NA
Indica I  595 94.10% 5.40% 0.50% 0.00% NA
Indica II  465 56.80% 43.00% 0.22% 0.00% NA
Indica III  913 85.90% 14.00% 0.11% 0.00% NA
Indica Intermediate  786 83.30% 15.60% 1.02% 0.00% NA
Temperate Japonica  767 1.40% 98.60% 0.00% 0.00% NA
Tropical Japonica  504 6.70% 92.90% 0.40% 0.00% NA
Japonica Intermediate  241 2.50% 97.10% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 42.20% 55.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701246321 T -> C LOC_Os07g03180.1 5_prime_UTR_variant ; 210.0bp to feature; MODIFIER silent_mutation Average:96.123; most accessible tissue: Callus, score: 98.545 N N N N
vg0701246321 T -> C LOC_Os07g03190.1 upstream_gene_variant ; 2553.0bp to feature; MODIFIER silent_mutation Average:96.123; most accessible tissue: Callus, score: 98.545 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0701246321 T C -0.02 -0.03 -0.02 -0.01 -0.02 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701246321 NA 2.40E-15 mr1167 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 1.26E-21 mr1167_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 9.51E-06 mr1269_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 5.42E-06 mr1289_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 6.03E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 6.77E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 4.30E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 1.90E-07 mr1479_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 4.99E-08 mr1668_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 1.64E-18 mr1726_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 5.19E-10 mr1761_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 1.31E-06 mr1786_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 5.36E-10 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701246321 NA 8.37E-16 mr1950_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251