\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701222286:

Variant ID: vg0701222286 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1222286
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CATAGCGGCTAGCTTTGGTCCCGCCGGCTGGCTATGGTGCCCGGCCCGGCTCAACTAATCGTCCTTTCAAGCCTCAAGTATTTTTAATTTTTCAATTCAT[C/T]
AGCTTAATACAGCTTGAAGTCTTATATTTCTTTTCCCCCCATTCTTTTCTCATGGCCCTGCGACGCTCGCGTGTTGCGCATTCGTTTGCTTCCTCAGTGG

Reverse complement sequence

CCACTGAGGAAGCAAACGAATGCGCAACACGCGAGCGTCGCAGGGCCATGAGAAAAGAATGGGGGGAAAAGAAATATAAGACTTCAAGCTGTATTAAGCT[G/A]
ATGAATTGAAAAATTAAAAATACTTGAGGCTTGAAAGGACGATTAGTTGAGCCGGGCCGGGCACCATAGCCAGCCGGCGGGACCAAAGCTAGCCGCTATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 95.30% 0.30% 4.32% 0.08% NA
All Indica  2759 99.20% 0.00% 0.76% 0.04% NA
All Japonica  1512 99.90% 0.00% 0.07% 0.00% NA
Aus  269 28.60% 4.80% 65.43% 1.12% NA
Indica I  595 98.80% 0.00% 1.01% 0.17% NA
Indica II  465 99.80% 0.00% 0.22% 0.00% NA
Indica III  913 99.80% 0.10% 0.11% 0.00% NA
Indica Intermediate  786 98.30% 0.00% 1.65% 0.00% NA
Temperate Japonica  767 100.00% 0.00% 0.00% 0.00% NA
Tropical Japonica  504 99.80% 0.00% 0.20% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 3.12% 0.00% NA
Intermediate  90 96.70% 0.00% 3.33% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701222286 C -> DEL N N silent_mutation Average:69.295; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0701222286 C -> T LOC_Os07g03150.1 upstream_gene_variant ; 4742.0bp to feature; MODIFIER silent_mutation Average:69.295; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0701222286 C -> T LOC_Os07g03150.2 upstream_gene_variant ; 4760.0bp to feature; MODIFIER silent_mutation Average:69.295; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0701222286 C -> T LOC_Os07g03150.3 upstream_gene_variant ; 4530.0bp to feature; MODIFIER silent_mutation Average:69.295; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N
vg0701222286 C -> T LOC_Os07g03150-LOC_Os07g03160 intergenic_region ; MODIFIER silent_mutation Average:69.295; most accessible tissue: Zhenshan97 flag leaf, score: 80.799 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701222286 NA 6.71E-06 mr1048 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 7.45E-08 mr1073 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 7.16E-07 mr1126 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 6.59E-06 mr1153 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 2.56E-14 mr1231 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 2.87E-07 mr1262 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 3.65E-07 mr1320 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 9.90E-06 mr1331 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 2.04E-06 mr1345 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 1.30E-06 mr1365 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 1.69E-12 mr1409 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 8.63E-07 mr1545 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 8.74E-45 mr1549 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 1.79E-53 mr1550 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 2.02E-06 mr1574 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 2.66E-13 mr1649 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 2.47E-06 NA mr1705 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 8.80E-42 mr1757 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 1.70E-08 mr1762 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 6.43E-07 mr1774 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 4.73E-09 mr1866 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 7.58E-07 mr1931 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 1.82E-36 mr1549_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 4.66E-50 mr1550_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701222286 NA 5.02E-28 mr1757_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251