Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701030912:

Variant ID: vg0701030912 (JBrowse)	Variation Type: SNP
Chromosome: chr07	Position: 1030912
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )

Flanking Sequence (100 bp) in Reference Genome:

GCTCAAAAGATTCATCTCGCAATTTCCATGTAAACTGTGCAATTAGTTTTTTTTATCTATTGCTCTATGCATGTGTCCAAAGATTCAATGTGACGTTTTT[G/A]
GGAAAAAAATTGGGAACTAAACAAGGCCCCAAAACAAATAGGCAAAATAATATATTATGAAAATATATTCAATTATAGATTTAATAAAACTAATTTGATG

Reverse complement sequence

CATCAAATTAGTTTTATTAAATCTATAATTGAATATATTTTCATAATATATTATTTTGCCTATTTGTTTTGGGGCCTTGTTTAGTTCCCAATTTTTTTCC[C/T]
AAAAACGTCACATTGAATCTTTGGACACATGCATAGAGCAATAGATAAAAAAAACTAATTGCACAGTTTACATGGAAATTGCGAGATGAATCTTTTGAGC

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	31.00%	18.20%	28.06%	22.77%	NA
All Indica	2759	22.20%	8.20%	36.75%	32.80%	NA
All Japonica	1512	50.20%	40.30%	7.54%	1.92%	NA
Aus	269	15.60%	0.40%	53.90%	30.11%	NA
Indica I	595	14.60%	0.20%	53.95%	31.26%	NA
Indica II	465	11.60%	36.10%	27.53%	24.73%	NA
Indica III	913	31.40%	0.00%	28.37%	40.20%	NA
Indica Intermediate	786	23.50%	7.40%	38.93%	30.15%	NA
Temperate Japonica	767	75.70%	14.20%	9.52%	0.52%	NA
Tropical Japonica	504	19.40%	71.40%	5.16%	3.97%	NA
Japonica Intermediate	241	33.20%	58.50%	6.22%	2.07%	NA
VI/Aromatic	96	24.00%	0.00%	27.08%	48.96%	NA
Intermediate	90	31.10%	23.30%	30.00%	15.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0701030912	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701030912	G -> A	LOC_Os07g02790.1	downstream_gene_variant ; 4486.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0701030912	G -> A	LOC_Os07g02790-LOC_Os07g02800	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0701030912	NA	1.90E-10	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	3.83E-06	mr1216	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	4.96E-07	mr1382	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	5.37E-10	mr1877	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	1.10E-06	mr1094_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	2.54E-08	mr1110_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	6.62E-10	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	1.70E-11	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701030912	NA	2.31E-08	mr1383_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251