| Variant ID: vg0701030912 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1030912 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.02, others allele: 0.00, population size: 122. )
GCTCAAAAGATTCATCTCGCAATTTCCATGTAAACTGTGCAATTAGTTTTTTTTATCTATTGCTCTATGCATGTGTCCAAAGATTCAATGTGACGTTTTT[G/A]
GGAAAAAAATTGGGAACTAAACAAGGCCCCAAAACAAATAGGCAAAATAATATATTATGAAAATATATTCAATTATAGATTTAATAAAACTAATTTGATG
CATCAAATTAGTTTTATTAAATCTATAATTGAATATATTTTCATAATATATTATTTTGCCTATTTGTTTTGGGGCCTTGTTTAGTTCCCAATTTTTTTCC[C/T]
AAAAACGTCACATTGAATCTTTGGACACATGCATAGAGCAATAGATAAAAAAAACTAATTGCACAGTTTACATGGAAATTGCGAGATGAATCTTTTGAGC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 31.00% | 18.20% | 28.06% | 22.77% | NA |
| All Indica | 2759 | 22.20% | 8.20% | 36.75% | 32.80% | NA |
| All Japonica | 1512 | 50.20% | 40.30% | 7.54% | 1.92% | NA |
| Aus | 269 | 15.60% | 0.40% | 53.90% | 30.11% | NA |
| Indica I | 595 | 14.60% | 0.20% | 53.95% | 31.26% | NA |
| Indica II | 465 | 11.60% | 36.10% | 27.53% | 24.73% | NA |
| Indica III | 913 | 31.40% | 0.00% | 28.37% | 40.20% | NA |
| Indica Intermediate | 786 | 23.50% | 7.40% | 38.93% | 30.15% | NA |
| Temperate Japonica | 767 | 75.70% | 14.20% | 9.52% | 0.52% | NA |
| Tropical Japonica | 504 | 19.40% | 71.40% | 5.16% | 3.97% | NA |
| Japonica Intermediate | 241 | 33.20% | 58.50% | 6.22% | 2.07% | NA |
| VI/Aromatic | 96 | 24.00% | 0.00% | 27.08% | 48.96% | NA |
| Intermediate | 90 | 31.10% | 23.30% | 30.00% | 15.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701030912 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701030912 | G -> A | LOC_Os07g02790.1 | downstream_gene_variant ; 4486.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701030912 | G -> A | LOC_Os07g02790-LOC_Os07g02800 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701030912 | NA | 1.90E-10 | mr1110 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 3.83E-06 | mr1216 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 4.96E-07 | mr1382 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 5.37E-10 | mr1877 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 1.10E-06 | mr1094_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 2.54E-08 | mr1110_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 6.62E-10 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 1.70E-11 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701030912 | NA | 2.31E-08 | mr1383_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |