\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0701005739:

Variant ID: vg0701005739 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 1005739
Reference Allele: GAlternative Allele: C
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 32. )

Flanking Sequence (100 bp) in Reference Genome:


TGACGGCCCGCAAATTCCAGTCTTGTTATGGGCCGTCACAAATGGAAGGATCTGTACTAGTGATCTGTGTTTATCAGTACTTACCATGAAACAAACAAAT[G/C]
ATGTGAAACGTGTTAATAAGTATATGTTAAATATTATAAAAATGATAGATAGATTTGTTAAAATATTATGTAAATGATGTGAGGGGTGATGATTAGATAT

Reverse complement sequence

ATATCTAATCATCACCCCTCACATCATTTACATAATATTTTAACAAATCTATCTATCATTTTTATAATATTTAACATATACTTATTAACACGTTTCACAT[C/G]
ATTTGTTTGTTTCATGGTAAGTACTGATAAACACAGATCACTAGTACAGATCCTTCCATTTGTGACGGCCCATAACAAGACTGGAATTTGCGGGCCGTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.00% 9.40% 3.41% 1.25% NA
All Indica  2759 79.00% 15.30% 5.55% 0.14% NA
All Japonica  1512 96.40% 0.40% 0.26% 2.98% NA
Aus  269 92.20% 4.80% 1.12% 1.86% NA
Indica I  595 59.20% 25.70% 14.96% 0.17% NA
Indica II  465 93.10% 5.60% 1.08% 0.22% NA
Indica III  913 87.60% 11.70% 0.55% 0.11% NA
Indica Intermediate  786 75.70% 17.30% 6.87% 0.13% NA
Temperate Japonica  767 99.20% 0.10% 0.26% 0.39% NA
Tropical Japonica  504 91.90% 1.00% 0.40% 6.75% NA
Japonica Intermediate  241 96.70% 0.00% 0.00% 3.32% NA
VI/Aromatic  96 94.80% 0.00% 1.04% 4.17% NA
Intermediate  90 95.60% 3.30% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0701005739 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701005739 G -> C LOC_Os07g02750.1 upstream_gene_variant ; 687.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701005739 G -> C LOC_Os07g02760.1 upstream_gene_variant ; 1060.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701005739 G -> C LOC_Os07g02760.3 upstream_gene_variant ; 1047.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701005739 G -> C LOC_Os07g02760.2 upstream_gene_variant ; 1047.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0701005739 G -> C LOC_Os07g02750-LOC_Os07g02760 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0701005739 NA 2.73E-07 mr1707 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701005739 NA 2.19E-07 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701005739 NA 5.52E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701005739 NA 7.12E-06 mr1492_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0701005739 2.53E-06 2.53E-06 mr1992_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251