| Variant ID: vg0701005739 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 1005739 |
| Reference Allele: G | Alternative Allele: C |
| Primary Allele: G | Secondary Allele: C |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.03, others allele: 0.00, population size: 32. )
TGACGGCCCGCAAATTCCAGTCTTGTTATGGGCCGTCACAAATGGAAGGATCTGTACTAGTGATCTGTGTTTATCAGTACTTACCATGAAACAAACAAAT[G/C]
ATGTGAAACGTGTTAATAAGTATATGTTAAATATTATAAAAATGATAGATAGATTTGTTAAAATATTATGTAAATGATGTGAGGGGTGATGATTAGATAT
ATATCTAATCATCACCCCTCACATCATTTACATAATATTTTAACAAATCTATCTATCATTTTTATAATATTTAACATATACTTATTAACACGTTTCACAT[C/G]
ATTTGTTTGTTTCATGGTAAGTACTGATAAACACAGATCACTAGTACAGATCCTTCCATTTGTGACGGCCCATAACAAGACTGGAATTTGCGGGCCGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.00% | 9.40% | 3.41% | 1.25% | NA |
| All Indica | 2759 | 79.00% | 15.30% | 5.55% | 0.14% | NA |
| All Japonica | 1512 | 96.40% | 0.40% | 0.26% | 2.98% | NA |
| Aus | 269 | 92.20% | 4.80% | 1.12% | 1.86% | NA |
| Indica I | 595 | 59.20% | 25.70% | 14.96% | 0.17% | NA |
| Indica II | 465 | 93.10% | 5.60% | 1.08% | 0.22% | NA |
| Indica III | 913 | 87.60% | 11.70% | 0.55% | 0.11% | NA |
| Indica Intermediate | 786 | 75.70% | 17.30% | 6.87% | 0.13% | NA |
| Temperate Japonica | 767 | 99.20% | 0.10% | 0.26% | 0.39% | NA |
| Tropical Japonica | 504 | 91.90% | 1.00% | 0.40% | 6.75% | NA |
| Japonica Intermediate | 241 | 96.70% | 0.00% | 0.00% | 3.32% | NA |
| VI/Aromatic | 96 | 94.80% | 0.00% | 1.04% | 4.17% | NA |
| Intermediate | 90 | 95.60% | 3.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0701005739 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701005739 | G -> C | LOC_Os07g02750.1 | upstream_gene_variant ; 687.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701005739 | G -> C | LOC_Os07g02760.1 | upstream_gene_variant ; 1060.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701005739 | G -> C | LOC_Os07g02760.3 | upstream_gene_variant ; 1047.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701005739 | G -> C | LOC_Os07g02760.2 | upstream_gene_variant ; 1047.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0701005739 | G -> C | LOC_Os07g02750-LOC_Os07g02760 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0701005739 | NA | 2.73E-07 | mr1707 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701005739 | NA | 2.19E-07 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701005739 | NA | 5.52E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701005739 | NA | 7.12E-06 | mr1492_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0701005739 | 2.53E-06 | 2.53E-06 | mr1992_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |