Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700837076:

Variant ID: vg0700837076 (JBrowse)	Variation Type: INDEL
Chromosome: chr07	Position: 837076
Reference Allele: G	Alternative Allele: A,GGTTATTGAGTTTGATTTTGATAAAAAA
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:

AATTAGCATCAAATGAAAATATATCAAAATCTAAAATTACTGATATAACATGTATAATACATGGTATAGATATAGCTAGTACGTATGGTCATTAGTCAAG[G/A,GGTTATTGAGTTTGATTTTGATAAAAAA]
GCTATCGAGTTTGATTTTGATAAAAAAGCATGGGACGGAAAGAGTAACTAACATAAATATCCTCATGCACTGCATCATGATTCAGCCTGCATGGCTCACT

Reverse complement sequence

AGTGAGCCATGCAGGCTGAATCATGATGCAGTGCATGAGGATATTTATGTTAGTTACTCTTTCCGTCCCATGCTTTTTTATCAAAATCAAACTCGATAGC[C/T,TTTTTTATCAAAATCAAACTCAATAACC]
CTTGACTAATGACCATACGTACTAGCTATATCTATACCATGTATTATACATGTTATATCAGTAATTTTAGATTTTGATATATTTTCATTTGATGCTAATT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	34.10%	10.10%	2.16%	53.64%	GGTTATTGAGTTTGATTTTGATAAAAAA: 0.06%
All Indica	2759	3.80%	11.40%	2.57%	82.24%	NA
All Japonica	1512	86.60%	9.90%	0.79%	2.71%	NA
Aus	269	21.90%	0.40%	4.09%	72.49%	GGTTATTGAGTTTGATTTTGATAAAAAA: 1.12%
Indica I	595	4.90%	0.20%	1.85%	93.11%	NA
Indica II	465	1.90%	50.10%	5.16%	42.80%	NA
Indica III	913	2.30%	0.00%	1.53%	96.17%	NA
Indica Intermediate	786	5.70%	10.30%	2.80%	81.17%	NA
Temperate Japonica	767	98.70%	0.10%	0.39%	0.78%	NA
Tropical Japonica	504	63.50%	28.80%	1.79%	5.95%	NA
Japonica Intermediate	241	96.70%	1.20%	0.00%	2.07%	NA
VI/Aromatic	96	91.70%	0.00%	1.04%	7.29%	NA
Intermediate	90	54.40%	12.20%	7.78%	25.56%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0700837076	G -> GGTTATTGAGTTTGATTTTGATAAAAAA	LOC_Os07g02420.1	upstream_gene_variant ; 4043.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> GGTTATTGAGTTTGATTTTGATAAAAAA	LOC_Os07g02430.1	upstream_gene_variant ; 1349.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> GGTTATTGAGTTTGATTTTGATAAAAAA	LOC_Os07g02440.1	upstream_gene_variant ; 993.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> GGTTATTGAGTTTGATTTTGATAAAAAA	LOC_Os07g02450.1	upstream_gene_variant ; 4789.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> GGTTATTGAGTTTGATTTTGATAAAAAA	LOC_Os07g02430-LOC_Os07g02440	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> DEL	N	N	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> A	LOC_Os07g02420.1	upstream_gene_variant ; 4042.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> A	LOC_Os07g02430.1	upstream_gene_variant ; 1348.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> A	LOC_Os07g02440.1	upstream_gene_variant ; 994.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> A	LOC_Os07g02450.1	upstream_gene_variant ; 4790.0bp to feature; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N
vg0700837076	G -> A	LOC_Os07g02430-LOC_Os07g02440	intergenic_region ; MODIFIER	silent_mutation	Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0700837076	NA	3.07E-06	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	5.27E-06	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	1.17E-07	mr1083	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	6.30E-09	mr1110	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	1.78E-06	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	2.89E-09	mr1794	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	1.06E-06	mr1068_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	8.31E-06	mr1094_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	1.94E-06	mr1096_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.11E-06	mr1112_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.33E-08	mr1121_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	5.00E-06	mr1158_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	2.02E-10	mr1158_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	8.39E-06	9.22E-08	mr1211_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	6.69E-07	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	9.38E-07	mr1248_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.45E-06	mr1268_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.37E-06	mr1268_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	9.92E-06	mr1360_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	6.81E-14	mr1383_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	9.18E-06	9.17E-06	mr1418_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	7.56E-06	mr1420_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	1.69E-06	mr1423_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	9.97E-06	mr1467_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	8.51E-06	mr1488_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	1.72E-06	1.72E-06	mr1506_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.30E-06	mr1608_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	3.87E-06	mr1759_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	2.22E-06	4.07E-10	mr1771_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	3.31E-07	1.98E-12	mr1784_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	7.20E-06	mr1786_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	1.14E-08	2.03E-13	mr1800_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	2.27E-06	NA	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	7.55E-06	2.90E-10	mr1862_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076	NA	4.20E-06	mr1896_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251