\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700837076:

Variant ID: vg0700837076 (JBrowse)Variation Type: INDEL
Chromosome: chr07Position: 837076
Reference Allele: GAlternative Allele: A,GGTTATTGAGTTTGATTTTGATAAAAAA
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.99, A: 0.01, others allele: 0.00, population size: 84. )

Flanking Sequence (100 bp) in Reference Genome:


AATTAGCATCAAATGAAAATATATCAAAATCTAAAATTACTGATATAACATGTATAATACATGGTATAGATATAGCTAGTACGTATGGTCATTAGTCAAG[G/A,GGTTATTGAGTTTGATTTTGATAAAAAA]
GCTATCGAGTTTGATTTTGATAAAAAAGCATGGGACGGAAAGAGTAACTAACATAAATATCCTCATGCACTGCATCATGATTCAGCCTGCATGGCTCACT

Reverse complement sequence

AGTGAGCCATGCAGGCTGAATCATGATGCAGTGCATGAGGATATTTATGTTAGTTACTCTTTCCGTCCCATGCTTTTTTATCAAAATCAAACTCGATAGC[C/T,TTTTTTATCAAAATCAAACTCAATAACC]
CTTGACTAATGACCATACGTACTAGCTATATCTATACCATGTATTATACATGTTATATCAGTAATTTTAGATTTTGATATATTTTCATTTGATGCTAATT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 34.10% 10.10% 2.16% 53.64% GGTTATTGAGTTTGATTTTGATAAAAAA: 0.06%
All Indica  2759 3.80% 11.40% 2.57% 82.24% NA
All Japonica  1512 86.60% 9.90% 0.79% 2.71% NA
Aus  269 21.90% 0.40% 4.09% 72.49% GGTTATTGAGTTTGATTTTGATAAAAAA: 1.12%
Indica I  595 4.90% 0.20% 1.85% 93.11% NA
Indica II  465 1.90% 50.10% 5.16% 42.80% NA
Indica III  913 2.30% 0.00% 1.53% 96.17% NA
Indica Intermediate  786 5.70% 10.30% 2.80% 81.17% NA
Temperate Japonica  767 98.70% 0.10% 0.39% 0.78% NA
Tropical Japonica  504 63.50% 28.80% 1.79% 5.95% NA
Japonica Intermediate  241 96.70% 1.20% 0.00% 2.07% NA
VI/Aromatic  96 91.70% 0.00% 1.04% 7.29% NA
Intermediate  90 54.40% 12.20% 7.78% 25.56% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700837076 G -> GGTTATTGAGTTTGATTTTGATAAAAAA LOC_Os07g02420.1 upstream_gene_variant ; 4043.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> GGTTATTGAGTTTGATTTTGATAAAAAA LOC_Os07g02430.1 upstream_gene_variant ; 1349.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> GGTTATTGAGTTTGATTTTGATAAAAAA LOC_Os07g02440.1 upstream_gene_variant ; 993.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> GGTTATTGAGTTTGATTTTGATAAAAAA LOC_Os07g02450.1 upstream_gene_variant ; 4789.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> GGTTATTGAGTTTGATTTTGATAAAAAA LOC_Os07g02430-LOC_Os07g02440 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> A LOC_Os07g02420.1 upstream_gene_variant ; 4042.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> A LOC_Os07g02430.1 upstream_gene_variant ; 1348.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> A LOC_Os07g02440.1 upstream_gene_variant ; 994.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> A LOC_Os07g02450.1 upstream_gene_variant ; 4790.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700837076 G -> A LOC_Os07g02430-LOC_Os07g02440 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700837076 NA 3.07E-06 mr1076 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 5.27E-06 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 1.17E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 6.30E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 1.78E-06 mr1226 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 2.89E-09 mr1794 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 1.06E-06 mr1068_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 8.31E-06 mr1094_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 1.94E-06 mr1096_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.11E-06 mr1112_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.33E-08 mr1121_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 5.00E-06 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 2.02E-10 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 8.39E-06 9.22E-08 mr1211_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 6.69E-07 mr1220_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 9.38E-07 mr1248_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.45E-06 mr1268_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.37E-06 mr1268_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 9.92E-06 mr1360_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 6.81E-14 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 9.18E-06 9.17E-06 mr1418_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 7.56E-06 mr1420_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 1.69E-06 mr1423_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 9.97E-06 mr1467_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 8.51E-06 mr1488_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 1.72E-06 1.72E-06 mr1506_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.30E-06 mr1608_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 3.87E-06 mr1759_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 2.22E-06 4.07E-10 mr1771_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 3.31E-07 1.98E-12 mr1784_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 7.20E-06 mr1786_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 1.14E-08 2.03E-13 mr1800_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 2.27E-06 NA mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 7.55E-06 2.90E-10 mr1862_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700837076 NA 4.20E-06 mr1896_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251