Search for Variation information by Variation ID:
Detailed information for vg0700688176:
| Variant ID: vg0700688176 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 688176 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
Flanking Sequence (100 bp) in Reference Genome:
AGAGGTAGACGACGTCGCGTCCGGCTCCGGCGCGGCGACGACATGGACGGCGAGGCGGAAGGAGAGGTAGGCGTCGACGCAGGCGTACTGCACCTGCTCC[T/A]
TGCTCAGCCTGCGCGCGTCCCACCTGCTCGTCCCGACCTTCCTCGGCTTCGTCGTCACCCCGTCCCACCCGAGGTGCTCCTCCGCCATGCGCTGCATCGA
Reverse complement sequence
TCGATGCAGCGCATGGCGGAGGAGCACCTCGGGTGGGACGGGGTGACGACGAAGCCGAGGAAGGTCGGGACGAGCAGGTGGGACGCGCGCAGGCTGAGCA[A/T]
GGAGCAGGTGCAGTACGCCTGCGTCGACGCCTACCTCTCCTTCCGCCTCGCCGTCCATGTCGTCGCCGCGCCGGAGCCGGACGCGACGTCGTCTACCTCT
Allele Frequencies:
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.50% | 13.40% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 77.60% | 22.40% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.30% | 0.60% | 0.07% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 72.10% | 27.90% | 0.00% | 0.00% | NA |
| Indica II | 465 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 68.00% | 32.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 81.40% | 18.60% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 98.00% | 1.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700688176 | T -> A | LOC_Os07g02150.1 | missense_variant ; p.Lys123Met; MODERATE | nonsynonymous_codon ; K123M | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | probably damaging  |
2.199 |
TOLERATED | 0.12 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700688176 | NA | 6.90E-06 | mr1723 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700688176 | NA | 1.71E-06 | mr1040_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700688176 | NA | 6.27E-07 | mr1053_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700688176 | NA | 6.41E-08 | mr1362_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700688176 | NA | 3.72E-09 | mr1723_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700688176 | NA | 1.52E-06 | mr1836_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |