\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700550440:

Variant ID: vg0700550440 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 550440
Reference Allele: GAlternative Allele: C,A
Primary Allele: GSecondary Allele: C

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, C: 0.01, others allele: 0.00, population size: 117. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGTTTTATTTCCATTCTATTCGTTCCATATCACTACAAAATGTTATTGAATTTGAGATGACCATTATTTATCTTTATCCTCTTTACAAAGAGAAGTTA[G/C,A]
GCAGCCTGTGCAGATTCGTAGTACTAGGAAATATCCCATCCAGTCCTGGTTCTTATATTTTAGGACGGAGGGAGTATTTGTCATTTTTGCCTATGTGGCA

Reverse complement sequence

TGCCACATAGGCAAAAATGACAAATACTCCCTCCGTCCTAAAATATAAGAACCAGGACTGGATGGGATATTTCCTAGTACTACGAATCTGCACAGGCTGC[C/G,T]
TAACTTCTCTTTGTAAAGAGGATAAAGATAAATAATGGTCATCTCAAATTCAATAACATTTTGTAGTGATATGGAACGAATAGAATGGAAATAAAACTAT

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.20% 9.60% 0.30% 0.93% A: 0.02%
All Indica  2759 86.20% 12.20% 0.07% 1.56% A: 0.04%
All Japonica  1512 92.40% 6.80% 0.79% 0.00% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 99.80% 0.20% 0.00% 0.00% NA
Indica II  465 45.80% 54.00% 0.00% 0.22% NA
Indica III  913 95.70% 0.00% 0.00% 4.16% A: 0.11%
Indica Intermediate  786 88.50% 10.70% 0.25% 0.51% NA
Temperate Japonica  767 99.20% 0.30% 0.52% 0.00% NA
Tropical Japonica  504 79.20% 19.20% 1.59% 0.00% NA
Japonica Intermediate  241 98.30% 1.70% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 83.30% 15.60% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700550440 G -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700550440 G -> A LOC_Os07g01904.1 5_prime_UTR_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700550440 G -> A LOC_Os07g01904.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700550440 G -> C LOC_Os07g01904.1 5_prime_UTR_variant ; 1234.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700550440 G -> C LOC_Os07g01904.2 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700550440 1.20E-07 2.22E-07 mr1076 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 7.21E-06 8.70E-07 mr1083 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 6.83E-09 mr1110 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 1.95E-06 mr1216 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 1.27E-07 5.60E-07 mr1226 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 6.51E-07 NA mr1411 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 4.98E-06 mr1479 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 3.77E-08 mr1925 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 1.26E-08 mr1929 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 2.92E-09 2.92E-09 mr1076_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 7.34E-07 6.02E-09 mr1082_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 1.10E-06 7.42E-09 mr1083_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 1.21E-06 NA mr1104_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 1.07E-06 4.94E-06 mr1107_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 1.42E-06 mr1110_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 2.25E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 1.87E-11 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 1.51E-06 1.36E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 7.43E-06 8.58E-15 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 4.96E-07 mr1408_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700550440 NA 7.03E-07 mr1498_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251