Variant ID: vg0700266518 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 266518 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 117. )
GGATAGTATAGGGGGACGAAAATATTGCGTAACGTGGGATAATTGTATTGAGCCTCAGGGGGGCAAAATATATAATAGTACATGGGGAGGAAATAAGGAA[G/A]
GATTACAGATATGGAAGAAATCCACACAAATCAATCAAATCCTAATATGACTCTAACTACCATATACTTTAACATTTTTTAACACCCCCATCTGCTCCTA
TAGGAGCAGATGGGGGTGTTAAAAAATGTTAAAGTATATGGTAGTTAGAGTCATATTAGGATTTGATTGATTTGTGTGGATTTCTTCCATATCTGTAATC[C/T]
TTCCTTATTTCCTCCCCATGTACTATTATATATTTTGCCCCCCTGAGGCTCAATACAATTATCCCACGTTACGCAATATTTTCGTCCCCCTATACTATCC
Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 63.60% | 35.90% | 0.42% | 0.06% | NA |
All Indica | 2759 | 41.10% | 58.30% | 0.51% | 0.11% | NA |
All Japonica | 1512 | 97.80% | 2.10% | 0.20% | 0.00% | NA |
Aus | 269 | 88.10% | 11.90% | 0.00% | 0.00% | NA |
Indica I | 595 | 57.10% | 42.20% | 0.67% | 0.00% | NA |
Indica II | 465 | 52.90% | 46.50% | 0.43% | 0.22% | NA |
Indica III | 913 | 30.10% | 69.70% | 0.22% | 0.00% | NA |
Indica Intermediate | 786 | 34.60% | 64.40% | 0.76% | 0.25% | NA |
Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
Tropical Japonica | 504 | 94.80% | 5.00% | 0.20% | 0.00% | NA |
Japonica Intermediate | 241 | 98.30% | 1.20% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 95.80% | 3.10% | 1.04% | 0.00% | NA |
Intermediate | 90 | 74.40% | 23.30% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0700266518 | G -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700266518 | G -> A | LOC_Os07g01410.1 | downstream_gene_variant ; 3774.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700266518 | G -> A | LOC_Os07g01420.1 | downstream_gene_variant ; 868.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700266518 | G -> A | LOC_Os07g01420-LOC_Os07g01430 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0700266518 | 3.96E-08 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | 5.28E-08 | 1.74E-10 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 1.95E-07 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 1.85E-11 | mr1316 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 1.99E-07 | mr1316 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 1.58E-06 | mr1352 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | 1.15E-08 | NA | mr1383 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | 3.20E-07 | 5.10E-10 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 4.55E-07 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 6.61E-09 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 6.79E-08 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700266518 | NA | 4.72E-07 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |