Variant ID: vg0700103970 (JBrowse) | Variation Type: SNP |
Chromosome: chr07 | Position: 103970 |
Reference Allele: C | Alternative Allele: T |
Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 89. )
GCAATATTCAACGTGATTTGCTCCGATTCTTGAGGGGAAATAAAGAGGAGGATAAGGGGAAGAAATCCCCTCAATCAATGTTTGAAACGAGCAACGGGAT[C/T]
GACCGAATTTGGAGGGGGAGGCAACAGTGTGGCGCACGGGCACGAGAGCTGGAGGTTGAAGATGTATAGTAGCGCGAGGGAGGGAAAATAGACTTTAGAT
ATCTAAAGTCTATTTTCCCTCCCTCGCGCTACTATACATCTTCAACCTCCAGCTCTCGTGCCCGTGCGCCACACTGTTGCCTCCCCCTCCAAATTCGGTC[G/A]
ATCCCGTTGCTCGTTTCAAACATTGATTGAGGGGATTTCTTCCCCTTATCCTCCTCTTTATTTCCCCTCAAGAATCGGAGCAAATCACGTTGAATATTGC
Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 66.30% | 33.10% | 0.34% | 0.25% | NA |
All Indica | 2759 | 78.10% | 21.20% | 0.33% | 0.33% | NA |
All Japonica | 1512 | 59.20% | 40.30% | 0.33% | 0.20% | NA |
Aus | 269 | 10.80% | 89.20% | 0.00% | 0.00% | NA |
Indica I | 595 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 47.10% | 50.30% | 0.65% | 1.94% | NA |
Indica III | 913 | 78.20% | 21.80% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 80.80% | 18.40% | 0.76% | 0.00% | NA |
Temperate Japonica | 767 | 84.90% | 14.90% | 0.26% | 0.00% | NA |
Tropical Japonica | 504 | 31.20% | 67.90% | 0.40% | 0.60% | NA |
Japonica Intermediate | 241 | 36.10% | 63.50% | 0.41% | 0.00% | NA |
VI/Aromatic | 96 | 8.30% | 91.70% | 0.00% | 0.00% | NA |
Intermediate | 90 | 52.20% | 45.60% | 2.22% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0700103970 | C -> DEL | N | N | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700103970 | C -> T | LOC_Os07g01160.1 | upstream_gene_variant ; 2266.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700103970 | C -> T | LOC_Os07g01170.1 | downstream_gene_variant ; 838.0bp to feature; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
vg0700103970 | C -> T | LOC_Os07g01160-LOC_Os07g01170 | intergenic_region ; MODIFIER | silent_mutation | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0700103970 | 8.99E-08 | 5.81E-09 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 1.00E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 6.02E-08 | mr1229 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | 2.42E-07 | 1.34E-09 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 5.36E-07 | mr1502 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 1.55E-06 | mr1657 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 5.48E-06 | mr1871 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 2.58E-11 | mr1158_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | 2.68E-07 | 2.99E-15 | mr1158_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | 2.80E-07 | 1.20E-07 | mr1168_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | 1.54E-09 | 6.37E-17 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0700103970 | NA | 2.83E-06 | mr1866_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |