\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700103970:

Variant ID: vg0700103970 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 103970
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 89. )

Flanking Sequence (100 bp) in Reference Genome:


GCAATATTCAACGTGATTTGCTCCGATTCTTGAGGGGAAATAAAGAGGAGGATAAGGGGAAGAAATCCCCTCAATCAATGTTTGAAACGAGCAACGGGAT[C/T]
GACCGAATTTGGAGGGGGAGGCAACAGTGTGGCGCACGGGCACGAGAGCTGGAGGTTGAAGATGTATAGTAGCGCGAGGGAGGGAAAATAGACTTTAGAT

Reverse complement sequence

ATCTAAAGTCTATTTTCCCTCCCTCGCGCTACTATACATCTTCAACCTCCAGCTCTCGTGCCCGTGCGCCACACTGTTGCCTCCCCCTCCAAATTCGGTC[G/A]
ATCCCGTTGCTCGTTTCAAACATTGATTGAGGGGATTTCTTCCCCTTATCCTCCTCTTTATTTCCCCTCAAGAATCGGAGCAAATCACGTTGAATATTGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 66.30% 33.10% 0.34% 0.25% NA
All Indica  2759 78.10% 21.20% 0.33% 0.33% NA
All Japonica  1512 59.20% 40.30% 0.33% 0.20% NA
Aus  269 10.80% 89.20% 0.00% 0.00% NA
Indica I  595 98.80% 1.20% 0.00% 0.00% NA
Indica II  465 47.10% 50.30% 0.65% 1.94% NA
Indica III  913 78.20% 21.80% 0.00% 0.00% NA
Indica Intermediate  786 80.80% 18.40% 0.76% 0.00% NA
Temperate Japonica  767 84.90% 14.90% 0.26% 0.00% NA
Tropical Japonica  504 31.20% 67.90% 0.40% 0.60% NA
Japonica Intermediate  241 36.10% 63.50% 0.41% 0.00% NA
VI/Aromatic  96 8.30% 91.70% 0.00% 0.00% NA
Intermediate  90 52.20% 45.60% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700103970 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700103970 C -> T LOC_Os07g01160.1 upstream_gene_variant ; 2266.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700103970 C -> T LOC_Os07g01170.1 downstream_gene_variant ; 838.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700103970 C -> T LOC_Os07g01160-LOC_Os07g01170 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700103970 8.99E-08 5.81E-09 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 1.00E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 6.02E-08 mr1229 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 2.42E-07 1.34E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 5.36E-07 mr1502 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 1.55E-06 mr1657 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 5.48E-06 mr1871 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 2.58E-11 mr1158_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 2.68E-07 2.99E-15 mr1158_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 2.80E-07 1.20E-07 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 1.54E-09 6.37E-17 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700103970 NA 2.83E-06 mr1866_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251