Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0700096792:

Variant ID: vg0700096792 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 96792
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.02, others allele: 0.00, population size: 123. )

Flanking Sequence (100 bp) in Reference Genome:


CATTGGGACCGCCCACCTAACCCCGCACACATGGCGTCCTGCAGAGGGGGTCGGAGCAGCCCGACCCCCAGGCATGGAAGTAAGTCAGAGGATTCTCTTC[C/T]
GTAGCTTTTAATAAATTAGAAACTTTTGTTGGAGAGCTCTTAGATTTTCAAATTTTTTTTTACCAAATTTGAATGACCAGTTCTAGCATGTCACCGACGA

Reverse complement sequence

TCGTCGGTGACATGCTAGAACTGGTCATTCAAATTTGGTAAAAAAAAATTTGAAAATCTAAGAGCTCTCCAACAAAAGTTTCTAATTTATTAAAAGCTAC[G/A]
GAAGAGAATCCTCTGACTTACTTCCATGCCTGGGGGTCGGGCTGCTCCGACCCCCTCTGCAGGACGCCATGTGTGCGGGGTTAGGTGGGCGGTCCCAATG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 62.80% 36.90% 0.32% 0.00% NA
All Indica  2759 39.50% 60.10% 0.40% 0.00% NA
All Japonica  1512 97.70% 2.10% 0.20% 0.00% NA
Aus  269 90.70% 9.30% 0.00% 0.00% NA
Indica I  595 53.40% 46.20% 0.34% 0.00% NA
Indica II  465 53.30% 46.20% 0.43% 0.00% NA
Indica III  913 29.50% 70.50% 0.00% 0.00% NA
Indica Intermediate  786 32.60% 66.50% 0.89% 0.00% NA
Temperate Japonica  767 99.30% 0.50% 0.13% 0.00% NA
Tropical Japonica  504 94.40% 5.20% 0.40% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 70.00% 28.90% 1.11% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700096792 C -> T LOC_Os07g01160.1 downstream_gene_variant ; 4160.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700096792 C -> T LOC_Os07g01150-LOC_Os07g01160 intergenic_region ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700096792 NA 1.27E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700096792 1.46E-07 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 5.18E-08 5.09E-11 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 3.06E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 3.87E-12 mr1316 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 8.08E-06 1.44E-08 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 4.29E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 1.73E-08 NA mr1383 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 1.13E-07 2.61E-10 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 3.12E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 2.60E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 3.07E-06 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 1.05E-07 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 1.33E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 8.69E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 7.57E-06 5.37E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 3.40E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 4.00E-06 NA mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700096792 NA 1.53E-07 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251