Search for Variation information by Variation ID:
Detailed information for vg0700050082:
| Variant ID: vg0700050082 (JBrowse) | Variation Type: SNP |
| Chromosome: chr07 | Position: 50082 |
| Reference Allele: A | Alternative Allele: C,G |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 277. )
Flanking Sequence (100 bp) in Reference Genome:
TGGTCTCAAAATTGGCAGGACAGTTGAACAAAGAAACAATGTGTAATACCATCTCTAAGCGATAGCACAAATGCTATAGTAATATAGATGAGACTGAAAA[A/C,G]
TGTTGAGAATCCCAACCAAATCCTGAGAGCAGAGAGATAAGGAATTCCGAAGGCAAAAAGAGCACAGACAAACCCAGATAATGCTATACAGTAGGGTAGC
Reverse complement sequence
GCTACCCTACTGTATAGCATTATCTGGGTTTGTCTGTGCTCTTTTTGCCTTCGGAATTCCTTATCTCTCTGCTCTCAGGATTTGGTTGGGATTCTCAACA[T/G,C]
TTTTCAGTCTCATCTATATTACTATAGCATTTGTGCTATCGCTTAGAGATGGTATTACACATTGTTTCTTTGTTCAACTGTCCTGCCAATTTTGAGACCA
Allele Frequencies:
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.60% | 46.20% | 0.25% | 0.00% | NA |
| All Indica | 2759 | 22.80% | 76.90% | 0.29% | 0.00% | NA |
| All Japonica | 1512 | 97.90% | 1.90% | 0.13% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica I | 595 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 53.30% | 46.00% | 0.65% | 0.00% | NA |
| Indica III | 913 | 22.60% | 77.40% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 20.40% | 79.00% | 0.64% | 0.00% | NA |
| Temperate Japonica | 767 | 99.50% | 0.40% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 95.00% | 4.80% | 0.20% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 26.70% | 2.22% | 0.00% | NA |
Allele Effect:
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0700050082 | A -> G | LOC_Os07g01090.1 | missense_variant ; p.Phe178Leu; MODERATE | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700050082 | A -> G | LOC_Os07g01090.2 | missense_variant ; p.Phe128Leu; MODERATE | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700050082 | A -> G | LOC_Os07g01080.1 | upstream_gene_variant ; 3928.0bp to feature; MODIFIER | N | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | N | N | N | N |
| vg0700050082 | A -> C | LOC_Os07g01090.1 | missense_variant ; p.Phe178Val; MODERATE | nonsynonymous_codon ; F178V | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign  |
-0.245 |
TOLERATED | 1.00 |
| vg0700050082 | A -> C | LOC_Os07g01090.2 | missense_variant ; p.Phe128Val; MODERATE | nonsynonymous_codon ; F128V | Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 | benign |
-0.292 |
TOLERATED | 1.00 |
Putative Genotype-Phenotype Associations:
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0700050082 | 2.74E-07 | NA | mr1158 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 1.01E-06 | 2.92E-08 | mr1158 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 3.69E-06 | mr1168 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 5.21E-10 | mr1195 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 3.94E-07 | NA | mr1383 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 1.91E-06 | 6.71E-09 | mr1383 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 8.04E-06 | mr1837 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 5.28E-08 | mr1158_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 1.22E-12 | mr1158_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 2.06E-08 | NA | mr1168_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 1.64E-08 | 1.89E-08 | mr1168_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 5.18E-07 | NA | mr1383_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | 5.48E-08 | 1.48E-15 | mr1383_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0700050082 | NA | 1.11E-06 | mr1925_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |