\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700050082:

Variant ID: vg0700050082 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 50082
Reference Allele: AAlternative Allele: C,G
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, C: 0.00, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


TGGTCTCAAAATTGGCAGGACAGTTGAACAAAGAAACAATGTGTAATACCATCTCTAAGCGATAGCACAAATGCTATAGTAATATAGATGAGACTGAAAA[A/C,G]
TGTTGAGAATCCCAACCAAATCCTGAGAGCAGAGAGATAAGGAATTCCGAAGGCAAAAAGAGCACAGACAAACCCAGATAATGCTATACAGTAGGGTAGC

Reverse complement sequence

GCTACCCTACTGTATAGCATTATCTGGGTTTGTCTGTGCTCTTTTTGCCTTCGGAATTCCTTATCTCTCTGCTCTCAGGATTTGGTTGGGATTCTCAACA[T/G,C]
TTTTCAGTCTCATCTATATTACTATAGCATTTGTGCTATCGCTTAGAGATGGTATTACACATTGTTTCTTTGTTCAACTGTCCTGCCAATTTTGAGACCA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 53.60% 46.20% 0.25% 0.00% NA
All Indica  2759 22.80% 76.90% 0.29% 0.00% NA
All Japonica  1512 97.90% 1.90% 0.13% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 2.50% 97.50% 0.00% 0.00% NA
Indica II  465 53.30% 46.00% 0.65% 0.00% NA
Indica III  913 22.60% 77.40% 0.00% 0.00% NA
Indica Intermediate  786 20.40% 79.00% 0.64% 0.00% NA
Temperate Japonica  767 99.50% 0.40% 0.13% 0.00% NA
Tropical Japonica  504 95.00% 4.80% 0.20% 0.00% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 71.10% 26.70% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700050082 A -> G LOC_Os07g01090.1 missense_variant ; p.Phe178Leu; MODERATE N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700050082 A -> G LOC_Os07g01090.2 missense_variant ; p.Phe128Leu; MODERATE N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700050082 A -> G LOC_Os07g01080.1 upstream_gene_variant ; 3928.0bp to feature; MODIFIER N Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700050082 A -> C LOC_Os07g01090.1 missense_variant ; p.Phe178Val; MODERATE nonsynonymous_codon ; F178V Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign -0.245 TOLERATED 1.00
vg0700050082 A -> C LOC_Os07g01090.2 missense_variant ; p.Phe128Val; MODERATE nonsynonymous_codon ; F128V Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 benign -0.292 TOLERATED 1.00

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700050082 2.74E-07 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 1.01E-06 2.92E-08 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 3.69E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 5.21E-10 mr1195 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 3.94E-07 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 1.91E-06 6.71E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 8.04E-06 mr1837 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 5.28E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 1.22E-12 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 2.06E-08 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 1.64E-08 1.89E-08 mr1168_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 5.18E-07 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 5.48E-08 1.48E-15 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700050082 NA 1.11E-06 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251