\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0700037565:

Variant ID: vg0700037565 (JBrowse)Variation Type: SNP
Chromosome: chr07Position: 37565
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.98, T: 0.01, others allele: 0.00, population size: 277. )

Flanking Sequence (100 bp) in Reference Genome:


ATGTTGTAAGAACTTGCATGGGGATCGCTTACTGTTGTCTCCAAAATTTTGGTATCTTGAATCCTATTTATCCATATGTCTTTATGTAGCTTGCACCTAG[C/T]
GAAGGAAAATGAAAATAATATGTCTAACTGCACAGTTGTTTGTTCTTTTTTATATAAAATAATAGCGTGGTAGTAGTGGCCATTCTATTCTGGTGGTCCT

Reverse complement sequence

AGGACCACCAGAATAGAATGGCCACTACTACCACGCTATTATTTTATATAAAAAAGAACAAACAACTGTGCAGTTAGACATATTATTTTCATTTTCCTTC[G/A]
CTAGGTGCAAGCTACATAAAGACATATGGATAAATAGGATTCAAGATACCAAAATTTTGGAGACAACAGTAAGCGATCCCCATGCAAGTTCTTACAACAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 63.40% 36.20% 0.06% 0.32% NA
All Indica  2759 39.70% 59.90% 0.11% 0.36% NA
All Japonica  1512 97.80% 2.00% 0.00% 0.20% NA
Aus  269 99.30% 0.70% 0.00% 0.00% NA
Indica I  595 52.90% 46.70% 0.34% 0.00% NA
Indica II  465 53.50% 45.80% 0.00% 0.65% NA
Indica III  913 29.60% 70.30% 0.11% 0.00% NA
Indica Intermediate  786 33.10% 66.00% 0.00% 0.89% NA
Temperate Japonica  767 99.30% 0.50% 0.00% 0.13% NA
Tropical Japonica  504 94.80% 4.80% 0.00% 0.40% NA
Japonica Intermediate  241 99.20% 0.80% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 4.20% 0.00% 0.00% NA
Intermediate  90 70.00% 27.80% 0.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0700037565 C -> DEL N N silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700037565 C -> T LOC_Os07g01050.1 upstream_gene_variant ; 3829.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700037565 C -> T LOC_Os07g01060.2 upstream_gene_variant ; 2332.0bp to feature; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700037565 C -> T LOC_Os07g01060.1 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N
vg0700037565 C -> T LOC_Os07g01060.3 intron_variant ; MODIFIER silent_mutation Average:4.21; most accessible tissue: Minghui63 panicle, score: 7.125 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0700037565 NA 1.60E-09 Heading_date Ind_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0700037565 3.40E-08 NA mr1158 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 3.21E-08 3.23E-11 mr1158 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 3.78E-06 mr1168 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 1.14E-14 mr1316 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 1.30E-06 1.86E-09 mr1316 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 1.80E-07 mr1352 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 5.35E-07 NA mr1383 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 7.09E-07 1.30E-09 mr1383 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 6.10E-06 mr1414 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 8.09E-06 mr1570 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 1.03E-06 mr1614 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 3.03E-06 mr1740 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 2.07E-07 mr1925 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 3.76E-07 mr1941 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 6.31E-06 2.73E-08 mr1158_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 1.33E-09 mr1158_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 4.09E-06 NA mr1168_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 4.02E-06 3.84E-08 mr1168_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 5.63E-06 mr1220_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 2.22E-06 mr1236_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 3.85E-06 NA mr1383_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 9.01E-07 1.89E-07 mr1383_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 3.41E-07 mr1498_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0700037565 NA 2.18E-08 mr1925_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251