\
| Variant ID: vg0631155509 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 31155509 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 340. )
TCAGTTCTCCTCAGCTGTGCCTTCTTTTATGACATCTTCTGGGTGTTTGTCTCCAAGAGATGGTTTCATGAGAGCGTGATGATCGTGGTAAGTTTTGTGG[A/G]
AATTTATTCTAGACTTCTGGTAATTGGTGATCTCATTGTTTAAGCTAAGTTGGTTATGCTGGTGTGCTTCTCAAAGGTAGCTCGTGGTGACAAGACTGAT
ATCAGTCTTGTCACCACGAGCTACCTTTGAGAAGCACACCAGCATAACCAACTTAGCTTAAACAATGAGATCACCAATTACCAGAAGTCTAGAATAAATT[T/C]
CCACAAAACTTACCACGATCATCACGCTCTCATGAAACCATCTCTTGGAGACAAACACCCAGAAGATGTCATAAAAGAAGGCACAGCTGAGGAGAACTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 95.00% | 2.90% | 2.14% | 0.00% | NA |
| All Indica | 2759 | 91.40% | 5.00% | 3.59% | 0.00% | NA |
| All Japonica | 1512 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.60% | 0.00% | 0.37% | 0.00% | NA |
| Indica I | 595 | 74.10% | 15.30% | 10.59% | 0.00% | NA |
| Indica II | 465 | 94.00% | 3.20% | 2.80% | 0.00% | NA |
| Indica III | 913 | 99.80% | 0.00% | 0.22% | 0.00% | NA |
| Indica Intermediate | 786 | 93.40% | 3.90% | 2.67% | 0.00% | NA |
| Temperate Japonica | 767 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 98.90% | 0.00% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0631155509 | A -> G | LOC_Os06g51440.1 | upstream_gene_variant ; 1820.0bp to feature; MODIFIER | silent_mutation | Average:69.746; most accessible tissue: Callus, score: 85.647 | N | N | N | N |
| vg0631155509 | A -> G | LOC_Os06g51420.1 | downstream_gene_variant ; 4964.0bp to feature; MODIFIER | silent_mutation | Average:69.746; most accessible tissue: Callus, score: 85.647 | N | N | N | N |
| vg0631155509 | A -> G | LOC_Os06g51430.1 | intron_variant ; MODIFIER | silent_mutation | Average:69.746; most accessible tissue: Callus, score: 85.647 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0631155509 | NA | 8.18E-11 | Heading_date | Ind_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0631155509 | 4.83E-08 | 3.30E-17 | mr1038 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 4.92E-07 | 3.70E-16 | mr1038 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 1.11E-06 | mr1125 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 1.60E-10 | 1.13E-22 | mr1389 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 1.26E-08 | 4.49E-19 | mr1389 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 1.85E-06 | mr1627 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 2.99E-06 | mr1002_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 4.57E-11 | 2.38E-25 | mr1038_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 8.30E-10 | 1.98E-22 | mr1038_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 3.29E-07 | mr1125_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 1.12E-06 | NA | mr1141_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 6.62E-06 | 3.67E-09 | mr1141_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 2.48E-06 | mr1152_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 4.63E-09 | 1.31E-21 | mr1389_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | 1.65E-07 | 1.18E-19 | mr1389_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 7.50E-07 | mr1653_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0631155509 | NA | 2.56E-06 | mr1864_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |