\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630592257:

Variant ID: vg0630592257 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30592257
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCGGCAAGGGCTCGAGCACCGGATGTTGGAGCTCGAGAACAATCCGTCAGAAATCCGATGCTCGCTGCGGGTATCGTACACCAGCCTACACCAGCTCGC[C/T]
GGGGAACGTGGTGTCACGACTACCAGCTGGCCTGCAAAATTTGCACATGAACGTACTACTTGCCTATAGATGATGGTGGTGTGGCCGTGTGGGCAATATT

Reverse complement sequence

AATATTGCCCACACGGCCACACCACCATCATCTATAGGCAAGTAGTACGTTCATGTGCAAATTTTGCAGGCCAGCTGGTAGTCGTGACACCACGTTCCCC[G/A]
GCGAGCTGGTGTAGGCTGGTGTACGATACCCGCAGCGAGCATCGGATTTCTGACGGATTGTTCTCGAGCTCCAACATCCGGTGCTCGAGCCCTTGCCGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 47.20% 6.30% 8.17% 38.36% NA
All Indica  2759 31.90% 0.80% 9.89% 57.45% NA
All Japonica  1512 64.00% 16.60% 6.88% 12.50% NA
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 5.90% 0.20% 9.08% 84.87% NA
Indica II  465 31.40% 0.90% 6.02% 61.72% NA
Indica III  913 50.40% 1.30% 12.16% 36.14% NA
Indica Intermediate  786 30.40% 0.50% 10.18% 58.91% NA
Temperate Japonica  767 86.00% 3.00% 2.09% 8.87% NA
Tropical Japonica  504 42.90% 32.30% 14.68% 10.12% NA
Japonica Intermediate  241 38.20% 27.00% 5.81% 29.05% NA
VI/Aromatic  96 78.10% 17.70% 1.04% 3.12% NA
Intermediate  90 45.60% 7.80% 8.89% 37.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630592257 C -> T LOC_Os06g50520.1 3_prime_UTR_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0630592257 C -> T LOC_Os06g50520.2 3_prime_UTR_variant ; 1013.0bp to feature; MODIFIER silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N
vg0630592257 C -> DEL N N silent_mutation Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630592257 4.88E-10 NA Grain_weight All YES Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630592257 NA 7.97E-06 Grain_weight Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0630592257 4.48E-06 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 4.55E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 3.67E-06 mr1414 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 6.14E-07 mr1554 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 1.98E-06 mr1077_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 1.84E-07 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630592257 NA 1.30E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251