| Variant ID: vg0630592257 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30592257 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCGGCAAGGGCTCGAGCACCGGATGTTGGAGCTCGAGAACAATCCGTCAGAAATCCGATGCTCGCTGCGGGTATCGTACACCAGCCTACACCAGCTCGC[C/T]
GGGGAACGTGGTGTCACGACTACCAGCTGGCCTGCAAAATTTGCACATGAACGTACTACTTGCCTATAGATGATGGTGGTGTGGCCGTGTGGGCAATATT
AATATTGCCCACACGGCCACACCACCATCATCTATAGGCAAGTAGTACGTTCATGTGCAAATTTTGCAGGCCAGCTGGTAGTCGTGACACCACGTTCCCC[G/A]
GCGAGCTGGTGTAGGCTGGTGTACGATACCCGCAGCGAGCATCGGATTTCTGACGGATTGTTCTCGAGCTCCAACATCCGGTGCTCGAGCCCTTGCCGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 47.20% | 6.30% | 8.17% | 38.36% | NA |
| All Indica | 2759 | 31.90% | 0.80% | 9.89% | 57.45% | NA |
| All Japonica | 1512 | 64.00% | 16.60% | 6.88% | 12.50% | NA |
| Aus | 269 | 99.30% | 0.00% | 0.00% | 0.74% | NA |
| Indica I | 595 | 5.90% | 0.20% | 9.08% | 84.87% | NA |
| Indica II | 465 | 31.40% | 0.90% | 6.02% | 61.72% | NA |
| Indica III | 913 | 50.40% | 1.30% | 12.16% | 36.14% | NA |
| Indica Intermediate | 786 | 30.40% | 0.50% | 10.18% | 58.91% | NA |
| Temperate Japonica | 767 | 86.00% | 3.00% | 2.09% | 8.87% | NA |
| Tropical Japonica | 504 | 42.90% | 32.30% | 14.68% | 10.12% | NA |
| Japonica Intermediate | 241 | 38.20% | 27.00% | 5.81% | 29.05% | NA |
| VI/Aromatic | 96 | 78.10% | 17.70% | 1.04% | 3.12% | NA |
| Intermediate | 90 | 45.60% | 7.80% | 8.89% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630592257 | C -> T | LOC_Os06g50520.1 | 3_prime_UTR_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0630592257 | C -> T | LOC_Os06g50520.2 | 3_prime_UTR_variant ; 1013.0bp to feature; MODIFIER | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| vg0630592257 | C -> DEL | N | N | silent_mutation | Average:27.582; most accessible tissue: Zhenshan97 panicle, score: 52.263 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630592257 | 4.88E-10 | NA | Grain_weight | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0630592257 | NA | 7.97E-06 | Grain_weight | Jap_All | Not | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg0630592257 | 4.48E-06 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 4.55E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 3.67E-06 | mr1414 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 6.14E-07 | mr1554 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 1.98E-06 | mr1077_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 1.84E-07 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630592257 | NA | 1.30E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |