| Variant ID: vg0630551197 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 30551197 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )
TGAGTAATTTTTTTAAGGGACTCTAGTTGACAAACAGCTGATTTCTCTTATACTCCCACCGTCCCAAAATAAGTGTAGTTTTGCACTATTTACGTTCAAC[G/A]
TTTGACCGTTCGTCTTATTTAAAATTTTTTTATGATTAGTATTTTTATTGCATTAGATGATAAAACATGAATAGTACTTTATGTGTGACTAAATATTTTC
GAAAATATTTAGTCACACATAAAGTACTATTCATGTTTTATCATCTAATGCAATAAAAATACTAATCATAAAAAAATTTTAAATAAGACGAACGGTCAAA[C/T]
GTTGAACGTAAATAGTGCAAAACTACACTTATTTTGGGACGGTGGGAGTATAAGAGAAATCAGCTGTTTGTCAACTAGAGTCCCTTAAAAAAATTACTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 86.20% | 3.90% | 6.45% | 3.41% | NA |
| All Indica | 2759 | 90.80% | 0.60% | 6.23% | 2.36% | NA |
| All Japonica | 1512 | 84.90% | 10.50% | 0.60% | 3.97% | NA |
| Aus | 269 | 56.10% | 0.40% | 30.86% | 12.64% | NA |
| Indica I | 595 | 96.60% | 0.00% | 0.84% | 2.52% | NA |
| Indica II | 465 | 95.90% | 0.90% | 1.94% | 1.29% | NA |
| Indica III | 913 | 82.80% | 1.20% | 13.91% | 2.08% | NA |
| Indica Intermediate | 786 | 92.60% | 0.30% | 3.94% | 3.18% | NA |
| Temperate Japonica | 767 | 97.80% | 1.00% | 0.52% | 0.65% | NA |
| Tropical Japonica | 504 | 70.20% | 28.20% | 0.20% | 1.39% | NA |
| Japonica Intermediate | 241 | 74.70% | 3.70% | 1.66% | 19.92% | NA |
| VI/Aromatic | 96 | 62.50% | 2.10% | 35.42% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 5.60% | 7.78% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0630551197 | G -> A | LOC_Os06g50460.1 | upstream_gene_variant ; 4404.0bp to feature; MODIFIER | silent_mutation | Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0630551197 | G -> A | LOC_Os06g50450.1 | downstream_gene_variant ; 930.0bp to feature; MODIFIER | silent_mutation | Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0630551197 | G -> A | LOC_Os06g50450-LOC_Os06g50460 | intergenic_region ; MODIFIER | silent_mutation | Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| vg0630551197 | G -> DEL | N | N | silent_mutation | Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0630551197 | NA | 8.50E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | NA | 5.78E-07 | mr1125 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | NA | 3.02E-07 | mr1136 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | 5.07E-08 | NA | mr1188 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | 1.39E-06 | 1.21E-09 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | NA | 6.67E-07 | mr1448 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | NA | 2.34E-06 | mr1700 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | NA | 2.90E-08 | mr1125_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | 2.02E-07 | NA | mr1188_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0630551197 | 9.14E-07 | 1.98E-12 | mr1188_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |