Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0630551197:

Variant ID: vg0630551197 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30551197
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:

TGAGTAATTTTTTTAAGGGACTCTAGTTGACAAACAGCTGATTTCTCTTATACTCCCACCGTCCCAAAATAAGTGTAGTTTTGCACTATTTACGTTCAAC[G/A]
TTTGACCGTTCGTCTTATTTAAAATTTTTTTATGATTAGTATTTTTATTGCATTAGATGATAAAACATGAATAGTACTTTATGTGTGACTAAATATTTTC

Reverse complement sequence

GAAAATATTTAGTCACACATAAAGTACTATTCATGTTTTATCATCTAATGCAATAAAAATACTAATCATAAAAAAATTTTAAATAAGACGAACGGTCAAA[C/T]
GTTGAACGTAAATAGTGCAAAACTACACTTATTTTGGGACGGTGGGAGTATAAGAGAAATCAGCTGTTTGTCAACTAGAGTCCCTTAAAAAAATTACTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	86.20%	3.90%	6.45%	3.41%	NA
All Indica	2759	90.80%	0.60%	6.23%	2.36%	NA
All Japonica	1512	84.90%	10.50%	0.60%	3.97%	NA
Aus	269	56.10%	0.40%	30.86%	12.64%	NA
Indica I	595	96.60%	0.00%	0.84%	2.52%	NA
Indica II	465	95.90%	0.90%	1.94%	1.29%	NA
Indica III	913	82.80%	1.20%	13.91%	2.08%	NA
Indica Intermediate	786	92.60%	0.30%	3.94%	3.18%	NA
Temperate Japonica	767	97.80%	1.00%	0.52%	0.65%	NA
Tropical Japonica	504	70.20%	28.20%	0.20%	1.39%	NA
Japonica Intermediate	241	74.70%	3.70%	1.66%	19.92%	NA
VI/Aromatic	96	62.50%	2.10%	35.42%	0.00%	NA
Intermediate	90	84.40%	5.60%	7.78%	2.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630551197	G -> A	LOC_Os06g50460.1	upstream_gene_variant ; 4404.0bp to feature; MODIFIER	silent_mutation	Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0630551197	G -> A	LOC_Os06g50450.1	downstream_gene_variant ; 930.0bp to feature; MODIFIER	silent_mutation	Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0630551197	G -> A	LOC_Os06g50450-LOC_Os06g50460	intergenic_region ; MODIFIER	silent_mutation	Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N
vg0630551197	G -> DEL	N	N	silent_mutation	Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630551197	NA	8.50E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	NA	5.78E-07	mr1125	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	NA	3.02E-07	mr1136	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	5.07E-08	NA	mr1188	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	1.39E-06	1.21E-09	mr1188	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	NA	6.67E-07	mr1448	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	NA	2.34E-06	mr1700	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	NA	2.90E-08	mr1125_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	2.02E-07	NA	mr1188_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197	9.14E-07	1.98E-12	mr1188_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251