\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630551197:

Variant ID: vg0630551197 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30551197
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, others allele: 0.00, population size: 250. )

Flanking Sequence (100 bp) in Reference Genome:


TGAGTAATTTTTTTAAGGGACTCTAGTTGACAAACAGCTGATTTCTCTTATACTCCCACCGTCCCAAAATAAGTGTAGTTTTGCACTATTTACGTTCAAC[G/A]
TTTGACCGTTCGTCTTATTTAAAATTTTTTTATGATTAGTATTTTTATTGCATTAGATGATAAAACATGAATAGTACTTTATGTGTGACTAAATATTTTC

Reverse complement sequence

GAAAATATTTAGTCACACATAAAGTACTATTCATGTTTTATCATCTAATGCAATAAAAATACTAATCATAAAAAAATTTTAAATAAGACGAACGGTCAAA[C/T]
GTTGAACGTAAATAGTGCAAAACTACACTTATTTTGGGACGGTGGGAGTATAAGAGAAATCAGCTGTTTGTCAACTAGAGTCCCTTAAAAAAATTACTCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 86.20% 3.90% 6.45% 3.41% NA
All Indica  2759 90.80% 0.60% 6.23% 2.36% NA
All Japonica  1512 84.90% 10.50% 0.60% 3.97% NA
Aus  269 56.10% 0.40% 30.86% 12.64% NA
Indica I  595 96.60% 0.00% 0.84% 2.52% NA
Indica II  465 95.90% 0.90% 1.94% 1.29% NA
Indica III  913 82.80% 1.20% 13.91% 2.08% NA
Indica Intermediate  786 92.60% 0.30% 3.94% 3.18% NA
Temperate Japonica  767 97.80% 1.00% 0.52% 0.65% NA
Tropical Japonica  504 70.20% 28.20% 0.20% 1.39% NA
Japonica Intermediate  241 74.70% 3.70% 1.66% 19.92% NA
VI/Aromatic  96 62.50% 2.10% 35.42% 0.00% NA
Intermediate  90 84.40% 5.60% 7.78% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630551197 G -> A LOC_Os06g50460.1 upstream_gene_variant ; 4404.0bp to feature; MODIFIER silent_mutation Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0630551197 G -> A LOC_Os06g50450.1 downstream_gene_variant ; 930.0bp to feature; MODIFIER silent_mutation Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0630551197 G -> A LOC_Os06g50450-LOC_Os06g50460 intergenic_region ; MODIFIER silent_mutation Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N
vg0630551197 G -> DEL N N silent_mutation Average:59.737; most accessible tissue: Minghui63 panicle, score: 83.421 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630551197 NA 8.50E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 NA 5.78E-07 mr1125 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 NA 3.02E-07 mr1136 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 5.07E-08 NA mr1188 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 1.39E-06 1.21E-09 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 NA 6.67E-07 mr1448 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 NA 2.34E-06 mr1700 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 NA 2.90E-08 mr1125_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 2.02E-07 NA mr1188_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630551197 9.14E-07 1.98E-12 mr1188_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251