\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630510502:

Variant ID: vg0630510502 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30510502
Reference Allele: AAlternative Allele: T
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.73, T: 0.27, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


AAAGACGGCCTCGGCCGGATCAACTTCGGCGACACCGGCAGCGCCGACCAGTCCGAGACGCCGTTCATCGTCAAATCCACACAGTAATTAAGCAAGCTTA[A/T]
CCTGTTCATGATTTGATCGAGCTGCGACAATTAACTGAATTACTACTGAATTTGTTGCTGCAGCTCCTACTACAACATCAGCATCACGTCGATGAGCGTC

Reverse complement sequence

GACGCTCATCGACGTGATGCTGATGTTGTAGTAGGAGCTGCAGCAACAAATTCAGTAGTAATTCAGTTAATTGTCGCAGCTCGATCAAATCATGAACAGG[T/A]
TAAGCTTGCTTAATTACTGTGTGGATTTGACGATGAACGGCGTCTCGGACTGGTCGGCGCTGCCGGTGTCGCCGAAGTTGATCCGGCCGAGGCCGTCTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 50.90% 49.00% 0.06% 0.00% NA
All Indica  2759 64.50% 35.40% 0.07% 0.00% NA
All Japonica  1512 21.00% 79.00% 0.07% 0.00% NA
Aus  269 79.90% 20.10% 0.00% 0.00% NA
Indica I  595 55.80% 44.00% 0.17% 0.00% NA
Indica II  465 69.50% 30.30% 0.22% 0.00% NA
Indica III  913 72.40% 27.60% 0.00% 0.00% NA
Indica Intermediate  786 58.90% 41.10% 0.00% 0.00% NA
Temperate Japonica  767 4.00% 96.00% 0.00% 0.00% NA
Tropical Japonica  504 44.00% 55.80% 0.20% 0.00% NA
Japonica Intermediate  241 26.60% 73.40% 0.00% 0.00% NA
VI/Aromatic  96 39.60% 60.40% 0.00% 0.00% NA
Intermediate  90 64.40% 35.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630510502 A -> T LOC_Os06g50390.1 intron_variant ; MODIFIER silent_mutation Average:82.461; most accessible tissue: Zhenshan97 root, score: 94.629 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0630510502 A T -0.01 -0.01 -0.01 -0.02 -0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630510502 6.79E-07 NA mr1125 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630510502 NA 2.45E-06 mr1532 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630510502 NA 8.11E-11 mr1553 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630510502 NA 8.88E-06 mr1553 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630510502 NA 2.58E-07 mr1781 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251