Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630508777:

Variant ID: vg0630508777 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30508777
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:

AAAATCGAACAAAACTCTAAAACATTTCTCTTTCTCTTTAGAGAATGATAATGATTTACATCTCTAACCTTTTCCATTAAGCATACAACTAATCCAATAC[T/C]
CTCTTTAGGGAGATTCTAGCAATTGCAACATCTTCCAGAATCTACAACTCTTCTAAACAGTCCAAATTCTTACTTAGGGTGTGTTTAGTTCACGCCAAAA

Reverse complement sequence

TTTTGGCGTGAACTAAACACACCCTAAGTAAGAATTTGGACTGTTTAGAAGAGTTGTAGATTCTGGAAGATGTTGCAATTGCTAGAATCTCCCTAAAGAG[A/G]
GTATTGGATTAGTTGTATGCTTAATGGAAAAGGTTAGAGATGTAAATCATTATCATTCTCTAAAGAGAAAGAGAAATGTTTTAGAGTTTTGTTCGATTTT

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	76.70%	22.90%	0.25%	0.17%	NA
All Indica	2759	66.60%	32.70%	0.43%	0.22%	NA
All Japonica	1512	89.00%	10.80%	0.00%	0.13%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	58.20%	41.30%	0.34%	0.17%	NA
Indica II	465	70.10%	29.00%	0.86%	0.00%	NA
Indica III	913	76.00%	23.50%	0.22%	0.22%	NA
Indica Intermediate	786	60.10%	39.10%	0.51%	0.38%	NA
Temperate Japonica	767	96.60%	3.30%	0.00%	0.13%	NA
Tropical Japonica	504	76.80%	23.00%	0.00%	0.20%	NA
Japonica Intermediate	241	90.50%	9.50%	0.00%	0.00%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	84.40%	15.60%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630508777	T -> C	LOC_Os06g50390.1	upstream_gene_variant ; 641.0bp to feature; MODIFIER	silent_mutation	Average:58.157; most accessible tissue: Callus, score: 73.271	N	N	N	N
vg0630508777	T -> C	LOC_Os06g50380-LOC_Os06g50390	intergenic_region ; MODIFIER	silent_mutation	Average:58.157; most accessible tissue: Callus, score: 73.271	N	N	N	N
vg0630508777	T -> DEL	N	N	silent_mutation	Average:58.157; most accessible tissue: Callus, score: 73.271	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630508777	NA	6.77E-10	mr1016	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	5.76E-11	mr1017	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	1.49E-10	mr1018	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	8.31E-12	mr1055	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	1.14E-10	mr1132	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	2.69E-11	mr1390	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	1.12E-12	mr1490	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	3.59E-06	NA	mr1522	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	8.10E-06	mr1627	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	4.94E-07	mr1951	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	3.69E-13	mr1055_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	5.53E-15	mr1132_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	5.40E-14	mr1390_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777	NA	9.36E-15	mr1490_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251