\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630508777:

Variant ID: vg0630508777 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30508777
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 1.00, C: 0.00, others allele: 0.00, population size: 213. )

Flanking Sequence (100 bp) in Reference Genome:


AAAATCGAACAAAACTCTAAAACATTTCTCTTTCTCTTTAGAGAATGATAATGATTTACATCTCTAACCTTTTCCATTAAGCATACAACTAATCCAATAC[T/C]
CTCTTTAGGGAGATTCTAGCAATTGCAACATCTTCCAGAATCTACAACTCTTCTAAACAGTCCAAATTCTTACTTAGGGTGTGTTTAGTTCACGCCAAAA

Reverse complement sequence

TTTTGGCGTGAACTAAACACACCCTAAGTAAGAATTTGGACTGTTTAGAAGAGTTGTAGATTCTGGAAGATGTTGCAATTGCTAGAATCTCCCTAAAGAG[A/G]
GTATTGGATTAGTTGTATGCTTAATGGAAAAGGTTAGAGATGTAAATCATTATCATTCTCTAAAGAGAAAGAGAAATGTTTTAGAGTTTTGTTCGATTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.70% 22.90% 0.25% 0.17% NA
All Indica  2759 66.60% 32.70% 0.43% 0.22% NA
All Japonica  1512 89.00% 10.80% 0.00% 0.13% NA
Aus  269 100.00% 0.00% 0.00% 0.00% NA
Indica I  595 58.20% 41.30% 0.34% 0.17% NA
Indica II  465 70.10% 29.00% 0.86% 0.00% NA
Indica III  913 76.00% 23.50% 0.22% 0.22% NA
Indica Intermediate  786 60.10% 39.10% 0.51% 0.38% NA
Temperate Japonica  767 96.60% 3.30% 0.00% 0.13% NA
Tropical Japonica  504 76.80% 23.00% 0.00% 0.20% NA
Japonica Intermediate  241 90.50% 9.50% 0.00% 0.00% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 84.40% 15.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630508777 T -> C LOC_Os06g50390.1 upstream_gene_variant ; 641.0bp to feature; MODIFIER silent_mutation Average:58.157; most accessible tissue: Callus, score: 73.271 N N N N
vg0630508777 T -> C LOC_Os06g50380-LOC_Os06g50390 intergenic_region ; MODIFIER silent_mutation Average:58.157; most accessible tissue: Callus, score: 73.271 N N N N
vg0630508777 T -> DEL N N silent_mutation Average:58.157; most accessible tissue: Callus, score: 73.271 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630508777 NA 6.77E-10 mr1016 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 5.76E-11 mr1017 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 1.49E-10 mr1018 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 8.31E-12 mr1055 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 1.14E-10 mr1132 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 2.69E-11 mr1390 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 1.12E-12 mr1490 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 3.59E-06 NA mr1522 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 8.10E-06 mr1627 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 4.94E-07 mr1951 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 3.69E-13 mr1055_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 5.53E-15 mr1132_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 5.40E-14 mr1390_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630508777 NA 9.36E-15 mr1490_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251