\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630077328:

Variant ID: vg0630077328 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 30077328
Reference Allele: AAlternative Allele: C
Primary Allele: ASecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACAACACAAGAGCAATACTGCATTCCACAAATGCCCAATCCAAACATAACCCAGTTTGCCACACAATTCCCCAACCGCATAGGCCAGTTCGCATCAGCAC[A/C]
ATCCTATTTTCAACCGGCGAGAGCAATCGATACCTAGAGCCCCCTGAGCCAAAATCTGCAAATGGCACCTTGGCCAATACATCTCAAGTTATCAAACATC

Reverse complement sequence

GATGTTTGATAACTTGAGATGTATTGGCCAAGGTGCCATTTGCAGATTTTGGCTCAGGGGGCTCTAGGTATCGATTGCTCTCGCCGGTTGAAAATAGGAT[T/G]
GTGCTGATGCGAACTGGCCTATGCGGTTGGGGAATTGTGTGGCAAACTGGGTTATGTTTGGATTGGGCATTTGTGGAATGCAGTATTGCTCTTGTGTTGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.30% 5.20% 5.29% 37.22% NA
All Indica  2759 54.50% 7.90% 8.37% 29.25% NA
All Japonica  1512 58.50% 1.30% 0.33% 39.95% NA
Aus  269 9.30% 0.40% 2.97% 87.36% NA
Indica I  595 37.10% 7.90% 2.86% 52.10% NA
Indica II  465 80.20% 2.20% 6.45% 11.18% NA
Indica III  913 56.00% 10.00% 12.92% 21.14% NA
Indica Intermediate  786 50.80% 8.80% 8.40% 32.06% NA
Temperate Japonica  767 94.00% 0.00% 0.39% 5.61% NA
Tropical Japonica  504 13.70% 3.40% 0.40% 82.54% NA
Japonica Intermediate  241 39.00% 0.80% 0.00% 60.17% NA
VI/Aromatic  96 11.50% 1.00% 0.00% 87.50% NA
Intermediate  90 54.40% 6.70% 6.67% 32.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0630077328 A -> C LOC_Os06g49720.1 upstream_gene_variant ; 1730.0bp to feature; MODIFIER silent_mutation Average:17.332; most accessible tissue: Callus, score: 35.687 N N N N
vg0630077328 A -> C LOC_Os06g49700.1 downstream_gene_variant ; 3572.0bp to feature; MODIFIER silent_mutation Average:17.332; most accessible tissue: Callus, score: 35.687 N N N N
vg0630077328 A -> C LOC_Os06g49710.1 downstream_gene_variant ; 1829.0bp to feature; MODIFIER silent_mutation Average:17.332; most accessible tissue: Callus, score: 35.687 N N N N
vg0630077328 A -> C LOC_Os06g49710-LOC_Os06g49720 intergenic_region ; MODIFIER silent_mutation Average:17.332; most accessible tissue: Callus, score: 35.687 N N N N
vg0630077328 A -> DEL N N silent_mutation Average:17.332; most accessible tissue: Callus, score: 35.687 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0630077328 NA 7.85E-08 mr1037 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 7.33E-07 mr1064 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 2.13E-06 mr1066 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 3.91E-06 mr1066 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 1.04E-06 1.66E-08 mr1078 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 7.05E-06 5.62E-06 mr1289 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 1.28E-06 1.28E-06 mr1370 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 1.81E-06 1.81E-06 mr1370 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 1.22E-06 mr1606 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 3.62E-06 5.57E-07 mr1606 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 3.10E-06 mr1669 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 9.30E-06 mr1741 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 8.84E-06 mr1788 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 5.25E-06 mr1788 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 2.02E-07 mr1887 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 1.27E-06 mr1887 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328 NA 2.55E-06 mr1981 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251