Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0630077328:

Variant ID: vg0630077328 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 30077328
Reference Allele: A	Alternative Allele: C
Primary Allele: A	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACAACACAAGAGCAATACTGCATTCCACAAATGCCCAATCCAAACATAACCCAGTTTGCCACACAATTCCCCAACCGCATAGGCCAGTTCGCATCAGCAC[A/C]
ATCCTATTTTCAACCGGCGAGAGCAATCGATACCTAGAGCCCCCTGAGCCAAAATCTGCAAATGGCACCTTGGCCAATACATCTCAAGTTATCAAACATC

Reverse complement sequence

GATGTTTGATAACTTGAGATGTATTGGCCAAGGTGCCATTTGCAGATTTTGGCTCAGGGGGCTCTAGGTATCGATTGCTCTCGCCGGTTGAAAATAGGAT[T/G]
GTGCTGATGCGAACTGGCCTATGCGGTTGGGGAATTGTGTGGCAAACTGGGTTATGTTTGGATTGGGCATTTGTGGAATGCAGTATTGCTCTTGTGTTGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	52.30%	5.20%	5.29%	37.22%	NA
All Indica	2759	54.50%	7.90%	8.37%	29.25%	NA
All Japonica	1512	58.50%	1.30%	0.33%	39.95%	NA
Aus	269	9.30%	0.40%	2.97%	87.36%	NA
Indica I	595	37.10%	7.90%	2.86%	52.10%	NA
Indica II	465	80.20%	2.20%	6.45%	11.18%	NA
Indica III	913	56.00%	10.00%	12.92%	21.14%	NA
Indica Intermediate	786	50.80%	8.80%	8.40%	32.06%	NA
Temperate Japonica	767	94.00%	0.00%	0.39%	5.61%	NA
Tropical Japonica	504	13.70%	3.40%	0.40%	82.54%	NA
Japonica Intermediate	241	39.00%	0.80%	0.00%	60.17%	NA
VI/Aromatic	96	11.50%	1.00%	0.00%	87.50%	NA
Intermediate	90	54.40%	6.70%	6.67%	32.22%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0630077328	A -> C	LOC_Os06g49720.1	upstream_gene_variant ; 1730.0bp to feature; MODIFIER	silent_mutation	Average:17.332; most accessible tissue: Callus, score: 35.687	N	N	N	N
vg0630077328	A -> C	LOC_Os06g49700.1	downstream_gene_variant ; 3572.0bp to feature; MODIFIER	silent_mutation	Average:17.332; most accessible tissue: Callus, score: 35.687	N	N	N	N
vg0630077328	A -> C	LOC_Os06g49710.1	downstream_gene_variant ; 1829.0bp to feature; MODIFIER	silent_mutation	Average:17.332; most accessible tissue: Callus, score: 35.687	N	N	N	N
vg0630077328	A -> C	LOC_Os06g49710-LOC_Os06g49720	intergenic_region ; MODIFIER	silent_mutation	Average:17.332; most accessible tissue: Callus, score: 35.687	N	N	N	N
vg0630077328	A -> DEL	N	N	silent_mutation	Average:17.332; most accessible tissue: Callus, score: 35.687	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0630077328	NA	7.85E-08	mr1037	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	7.33E-07	mr1064	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	2.13E-06	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	3.91E-06	mr1066	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	1.04E-06	1.66E-08	mr1078	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	7.05E-06	5.62E-06	mr1289	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	1.28E-06	1.28E-06	mr1370	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	1.81E-06	1.81E-06	mr1370	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	1.22E-06	mr1606	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	3.62E-06	5.57E-07	mr1606	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	3.10E-06	mr1669	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	9.30E-06	mr1741	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	8.84E-06	mr1788	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	5.25E-06	mr1788	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	2.02E-07	mr1887	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	1.27E-06	mr1887	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0630077328	NA	2.55E-06	mr1981	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251