Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0629161828:

Variant ID: vg0629161828 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 29161828
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.80, A: 0.20, others allele: 0.00, population size: 86. )

Flanking Sequence (100 bp) in Reference Genome:

CCCTCCATTTTTATAATATAAAACTTGTTTATATTTATATAAATGTTAATGAATATAGACACACATATATATCTAGATTCATTAACATATCTATAAACTT[G/A]
GGTAATGCTAAAATATTTACTTTATAAAACAGAGAAAATACTACGTATAAGAAAATTTGGTTGGATGTGATATATCCTACTACAAATAGTACATCACATC

Reverse complement sequence

GATGTGATGTACTATTTGTAGTAGGATATATCACATCCAACCAAATTTTCTTATACGTAGTATTTTCTCTGTTTTATAAAGTAAATATTTTAGCATTACC[C/T]
AAGTTTATAGATATGTTAATGAATCTAGATATATATGTGTGTCTATATTCATTAACATTTATATAAATATAAACAAGTTTTATATTATAAAAATGGAGGG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	93.90%	6.00%	0.17%	0.00%	NA
All Indica	2759	98.20%	1.80%	0.04%	0.00%	NA
All Japonica	1512	84.40%	15.10%	0.46%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	91.80%	8.10%	0.17%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.70%	0.30%	0.00%	0.00%	NA
Temperate Japonica	767	69.60%	29.50%	0.91%	0.00%	NA
Tropical Japonica	504	99.80%	0.20%	0.00%	0.00%	NA
Japonica Intermediate	241	99.20%	0.80%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0629161828	G -> A	LOC_Os06g48200.1	upstream_gene_variant ; 3945.0bp to feature; MODIFIER	silent_mutation	Average:81.574; most accessible tissue: Minghui63 panicle, score: 98.892	N	N	N	N
vg0629161828	G -> A	LOC_Os06g48210.1	upstream_gene_variant ; 1961.0bp to feature; MODIFIER	silent_mutation	Average:81.574; most accessible tissue: Minghui63 panicle, score: 98.892	N	N	N	N
vg0629161828	G -> A	LOC_Os06g48200-LOC_Os06g48210	intergenic_region ; MODIFIER	silent_mutation	Average:81.574; most accessible tissue: Minghui63 panicle, score: 98.892	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0629161828	G	A	0.03	0.01	0.0	-0.02	-0.01	0.0

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0629161828	NA	7.25E-09	mr1210	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	1.17E-06	NA	mr1300	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	1.03E-07	mr1305	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	5.21E-06	mr1515	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	3.88E-11	mr1585	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	2.67E-09	mr1586	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	3.26E-07	mr1765	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	1.56E-06	6.00E-11	mr1959	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	3.95E-09	mr1305_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	1.16E-08	mr1585_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	1.16E-10	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	3.44E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0629161828	NA	1.94E-07	mr1765_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251