\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628822462:

Variant ID: vg0628822462 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28822462
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTCGCGGCAAAACACTTCATTTCAGTGTACTACTATACTCCGGGCGTGTACAGCTCTAACTTCTAAATTAACTTTAGGAGTTGAGTCTAGAGTAGAGTT[G/A]
TGGAGCTATCTAAATCCAGCTCCACAACTCTAGTTTATTTTGTAAGAGAGCTCCATCCAGCTCCACTCTTAGTTTTGGTAGAGCTGAACAGACCCATGCC

Reverse complement sequence

GGCATGGGTCTGTTCAGCTCTACCAAAACTAAGAGTGGAGCTGGATGGAGCTCTCTTACAAAATAAACTAGAGTTGTGGAGCTGGATTTAGATAGCTCCA[C/T]
AACTCTACTCTAGACTCAACTCCTAAAGTTAATTTAGAAGTTAGAGCTGTACACGCCCGGAGTATAGTAGTACACTGAAATGAAGTGTTTTGCCGCGACG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 93.50% 0.20% 1.33% 4.93% NA
All Indica  2759 90.80% 0.20% 1.12% 7.83% NA
All Japonica  1512 99.70% 0.00% 0.13% 0.20% NA
Aus  269 86.20% 1.50% 11.15% 1.12% NA
Indica I  595 90.40% 0.30% 1.51% 7.73% NA
Indica II  465 91.60% 0.00% 0.86% 7.53% NA
Indica III  913 89.40% 0.30% 0.99% 9.31% NA
Indica Intermediate  786 92.40% 0.10% 1.15% 6.36% NA
Temperate Japonica  767 99.30% 0.00% 0.26% 0.39% NA
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 100.00% 0.00% 0.00% 0.00% NA
VI/Aromatic  96 95.80% 0.00% 0.00% 4.17% NA
Intermediate  90 91.10% 1.10% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628822462 G -> A LOC_Os06g47600.1 upstream_gene_variant ; 3368.0bp to feature; MODIFIER silent_mutation Average:87.422; most accessible tissue: Callus, score: 99.205 N N N N
vg0628822462 G -> A LOC_Os06g47590.1 downstream_gene_variant ; 3282.0bp to feature; MODIFIER silent_mutation Average:87.422; most accessible tissue: Callus, score: 99.205 N N N N
vg0628822462 G -> A LOC_Os06g47590-LOC_Os06g47600 intergenic_region ; MODIFIER silent_mutation Average:87.422; most accessible tissue: Callus, score: 99.205 N N N N
vg0628822462 G -> DEL N N silent_mutation Average:87.422; most accessible tissue: Callus, score: 99.205 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg0628822462 G A -0.05 -0.02 0.0 0.02 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628822462 NA 4.17E-35 mr1105 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 2.27E-43 mr1136 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 8.76E-11 mr1172 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 2.18E-12 mr1449 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 2.95E-07 5.87E-47 mr1480 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 3.88E-20 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 4.75E-29 mr1638 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 1.05E-13 mr1653 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 5.74E-06 1.79E-54 mr1692 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 1.20E-21 mr1839 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 1.25E-19 mr1968 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 4.09E-30 mr1105_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 1.93E-24 mr1350_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 7.50E-54 mr1480_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 2.74E-25 mr1653_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 1.10E-07 mr1681_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 2.78E-18 mr1682_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 2.55E-07 mr1683_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628822462 NA 3.93E-22 mr1968_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251