\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628751779:

Variant ID: vg0628751779 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28751779
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.97, A: 0.03, others allele: 0.00, population size: 101. )

Flanking Sequence (100 bp) in Reference Genome:


CATTTAGAAAAATTATTGTTGTTGTTGTCTAGAGTTTCAAATGCAGTAGATTTAGAAGAACCTATTTAATGAATTTTGAAAAGATTGAGGAACGATTAAC[T/A]
TATAGTAATAACTGTATTTATGTAAAGATTTAAGCGTTGTAAAAGAATTAATACATAAAGCAAAATTATGTATAAAAATTATGTATAGTACTTGCCTATT

Reverse complement sequence

AATAGGCAAGTACTATACATAATTTTTATACATAATTTTGCTTTATGTATTAATTCTTTTACAACGCTTAAATCTTTACATAAATACAGTTATTACTATA[A/T]
GTTAATCGTTCCTCAATCTTTTCAAAATTCATTAAATAGGTTCTTCTAAATCTACTGCATTTGAAACTCTAGACAACAACAACAATAATTTTTCTAAATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 52.90% 30.70% 5.10% 11.26% NA
All Indica  2759 28.20% 51.60% 7.87% 12.36% NA
All Japonica  1512 96.20% 0.30% 0.46% 3.04% NA
Aus  269 80.30% 0.70% 3.35% 15.61% NA
Indica I  595 12.10% 57.50% 14.12% 16.30% NA
Indica II  465 60.60% 22.20% 7.31% 9.89% NA
Indica III  913 17.90% 68.60% 2.96% 10.62% NA
Indica Intermediate  786 33.10% 44.90% 9.16% 12.85% NA
Temperate Japonica  767 97.00% 0.30% 0.26% 2.48% NA
Tropical Japonica  504 94.40% 0.20% 0.79% 4.56% NA
Japonica Intermediate  241 97.10% 0.80% 0.41% 1.66% NA
VI/Aromatic  96 10.40% 3.10% 4.17% 82.29% NA
Intermediate  90 48.90% 20.00% 4.44% 26.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628751779 T -> A LOC_Os06g47460.1 downstream_gene_variant ; 4667.0bp to feature; MODIFIER silent_mutation Average:20.375; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0628751779 T -> A LOC_Os06g47470.1 downstream_gene_variant ; 770.0bp to feature; MODIFIER silent_mutation Average:20.375; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0628751779 T -> A LOC_Os06g47460-LOC_Os06g47470 intergenic_region ; MODIFIER silent_mutation Average:20.375; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N
vg0628751779 T -> DEL N N silent_mutation Average:20.375; most accessible tissue: Minghui63 panicle, score: 38.588 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628751779 NA 7.31E-08 mr1050 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 7.58E-06 mr1163 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 4.55E-07 mr1174 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 5.88E-06 mr1974 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 1.48E-06 1.48E-06 mr1035_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 1.73E-06 mr1354_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 6.81E-07 mr1355_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 8.87E-06 mr1462_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 6.96E-07 mr1631_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 2.57E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 1.67E-06 mr1875_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 4.19E-06 mr1882_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 1.27E-08 mr1895_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 2.42E-07 mr1895_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 2.70E-06 mr1899_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 2.12E-07 mr1931_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628751779 NA 8.19E-07 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251