\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628386367:

Variant ID: vg0628386367 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28386367
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


AAAAAACCAGCGAAAAAAAAACCAAAATTATCCGATCCAAAAAAAATAGGGCGTTGCTCCCCTCAAAATGCTTCCTTGCTCTGTGTACTTTGTTCAACAG[G/A]
ATCAAGGGAAACAACTCTCCACTTATTTTTCCAGTGTCCTTTTAGCACTCAATGTTGGGCGTAATTTAGTGTGGTTTGGAATCTTTCTTTAAGCTTTGGT

Reverse complement sequence

ACCAAAGCTTAAAGAAAGATTCCAAACCACACTAAATTACGCCCAACATTGAGTGCTAAAAGGACACTGGAAAAATAAGTGGAGAGTTGTTTCCCTTGAT[C/T]
CTGTTGAACAAAGTACACAGAGCAAGGAAGCATTTTGAGGGGAGCAACGCCCTATTTTTTTTGGATCGGATAATTTTGGTTTTTTTTTCGCTGGTTTTTT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 60.50% 39.50% 0.00% 0.00% NA
All Indica  2759 94.30% 5.70% 0.00% 0.00% NA
All Japonica  1512 4.70% 95.30% 0.00% 0.00% NA
Aus  269 51.30% 48.70% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 93.80% 6.20% 0.00% 0.00% NA
Indica III  913 95.40% 4.60% 0.00% 0.00% NA
Indica Intermediate  786 90.50% 9.50% 0.00% 0.00% NA
Temperate Japonica  767 3.30% 96.70% 0.00% 0.00% NA
Tropical Japonica  504 7.90% 92.10% 0.00% 0.00% NA
Japonica Intermediate  241 2.50% 97.50% 0.00% 0.00% NA
VI/Aromatic  96 2.10% 97.90% 0.00% 0.00% NA
Intermediate  90 54.40% 45.60% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628386367 G -> A LOC_Os06g46730.1 upstream_gene_variant ; 562.0bp to feature; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg0628386367 G -> A LOC_Os06g46720.1 downstream_gene_variant ; 3878.0bp to feature; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg0628386367 G -> A LOC_Os06g46740.1 downstream_gene_variant ; 1929.0bp to feature; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg0628386367 G -> A LOC_Os06g46754.1 downstream_gene_variant ; 3964.0bp to feature; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg0628386367 G -> A LOC_Os06g46754.2 downstream_gene_variant ; 3964.0bp to feature; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg0628386367 G -> A LOC_Os06g46730-LOC_Os06g46740 intergenic_region ; MODIFIER silent_mutation Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628386367 3.45E-06 NA mr1166 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 5.29E-06 mr1210 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 8.36E-06 mr1305 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 1.45E-08 mr1342 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 6.86E-19 mr1566 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 6.64E-07 mr1586 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 8.49E-19 mr1598 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 1.11E-12 mr1609 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628386367 NA 4.19E-23 mr1609_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251