\
| Variant ID: vg0628386367 (JBrowse) | Variation Type: SNP |
| Chromosome: chr06 | Position: 28386367 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.89, A: 0.10, others allele: 0.00, population size: 105. )
AAAAAACCAGCGAAAAAAAAACCAAAATTATCCGATCCAAAAAAAATAGGGCGTTGCTCCCCTCAAAATGCTTCCTTGCTCTGTGTACTTTGTTCAACAG[G/A]
ATCAAGGGAAACAACTCTCCACTTATTTTTCCAGTGTCCTTTTAGCACTCAATGTTGGGCGTAATTTAGTGTGGTTTGGAATCTTTCTTTAAGCTTTGGT
ACCAAAGCTTAAAGAAAGATTCCAAACCACACTAAATTACGCCCAACATTGAGTGCTAAAAGGACACTGGAAAAATAAGTGGAGAGTTGTTTCCCTTGAT[C/T]
CTGTTGAACAAAGTACACAGAGCAAGGAAGCATTTTGAGGGGAGCAACGCCCTATTTTTTTTGGATCGGATAATTTTGGTTTTTTTTTCGCTGGTTTTTT
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 60.50% | 39.50% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 94.30% | 5.70% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 4.70% | 95.30% | 0.00% | 0.00% | NA |
| Aus | 269 | 51.30% | 48.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 98.00% | 2.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 93.80% | 6.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 95.40% | 4.60% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.50% | 9.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 3.30% | 96.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 7.90% | 92.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 2.50% | 97.50% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 2.10% | 97.90% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 54.40% | 45.60% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg0628386367 | G -> A | LOC_Os06g46730.1 | upstream_gene_variant ; 562.0bp to feature; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg0628386367 | G -> A | LOC_Os06g46720.1 | downstream_gene_variant ; 3878.0bp to feature; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg0628386367 | G -> A | LOC_Os06g46740.1 | downstream_gene_variant ; 1929.0bp to feature; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg0628386367 | G -> A | LOC_Os06g46754.1 | downstream_gene_variant ; 3964.0bp to feature; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg0628386367 | G -> A | LOC_Os06g46754.2 | downstream_gene_variant ; 3964.0bp to feature; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg0628386367 | G -> A | LOC_Os06g46730-LOC_Os06g46740 | intergenic_region ; MODIFIER | silent_mutation | Average:35.386; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg0628386367 | 3.45E-06 | NA | mr1166 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 5.29E-06 | mr1210 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 8.36E-06 | mr1305 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 1.45E-08 | mr1342 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 6.86E-19 | mr1566 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 6.64E-07 | mr1586 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 8.49E-19 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 1.11E-12 | mr1609 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg0628386367 | NA | 4.19E-23 | mr1609_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |