Variant ID: vg0628339348 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 28339348 |
Reference Allele: G | Alternative Allele: T |
Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CACCAACCGAGACTAAAAATCATCTTTACTCCCGGTTCATCCCGTGTCAGTAGTTTGTCAGGGGGGCGATGATCTTTAGTCCCGGTTGGTGACATCAACC[G/T]
GGACTAAAGATCATCTTTATAGTCATCTTTATAGTCCCGGTTGATAATACTAACCAGGACTAAAAATTATATTGATCTTTAGTCCCGGTTAGTATTACCA
TGGTAATACTAACCGGGACTAAAGATCAATATAATTTTTAGTCCTGGTTAGTATTATCAACCGGGACTATAAAGATGACTATAAAGATGATCTTTAGTCC[C/A]
GGTTGATGTCACCAACCGGGACTAAAGATCATCGCCCCCCTGACAAACTACTGACACGGGATGAACCGGGAGTAAAGATGATTTTTAGTCTCGGTTGGTG
Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 89.30% | 9.20% | 1.52% | 0.00% | NA |
All Indica | 2759 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
All Japonica | 1512 | 67.20% | 28.00% | 4.76% | 0.00% | NA |
Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Indica III | 913 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
Indica Intermediate | 786 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
Temperate Japonica | 767 | 56.50% | 36.20% | 7.30% | 0.00% | NA |
Tropical Japonica | 504 | 90.70% | 8.70% | 0.60% | 0.00% | NA |
Japonica Intermediate | 241 | 52.30% | 42.30% | 5.39% | 0.00% | NA |
VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0628339348 | G -> T | LOC_Os06g46650.1 | upstream_gene_variant ; 2466.0bp to feature; MODIFIER | silent_mutation | Average:42.764; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
vg0628339348 | G -> T | LOC_Os06g46650-LOC_Os06g46670 | intergenic_region ; MODIFIER | silent_mutation | Average:42.764; most accessible tissue: Minghui63 young leaf, score: 61.887 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0628339348 | 4.89E-06 | NA | mr1210 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | NA | 7.69E-06 | mr1210 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | 2.47E-07 | NA | mr1585 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | NA | 4.67E-09 | mr1585 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | 6.29E-09 | NA | mr1586 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | NA | 3.87E-07 | mr1586 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | 5.84E-06 | NA | mr1305_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | 4.86E-06 | NA | mr1585_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628339348 | NA | 6.83E-07 | mr1585_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |