Variant ID: vg0628275391 (JBrowse) | Variation Type: SNP |
Chromosome: chr06 | Position: 28275391 |
Reference Allele: G | Alternative Allele: A |
Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
CAGTTTAAGATTATTATAGTCTAGATTATTGAGCCAGATTACTATAAGCTGAATTATAATAAGCCGATATAGAATAAGCGGTTAGCTGTTTGTTTATCTG[G/A]
ATTATTAGCTGTTTGTTCGCGGTTAGCAACCCAACAATTTAAAAAAGCACATTTAGAGTGGATTATTAGATTATAATAATCTAACTTATAGATTATAATA
TATTATAATCTATAAGTTAGATTATTATAATCTAATAATCCACTCTAAATGTGCTTTTTTAAATTGTTGGGTTGCTAACCGCGAACAAACAGCTAATAAT[C/T]
CAGATAAACAAACAGCTAACCGCTTATTCTATATCGGCTTATTATAATTCAGCTTATAGTAATCTGGCTCAATAATCTAGACTATAATAATCTTAAACTG
Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
---|---|---|---|---|---|---|
All | 4726 | 56.00% | 43.90% | 0.13% | 0.00% | NA |
All Indica | 2759 | 89.50% | 10.30% | 0.22% | 0.00% | NA |
All Japonica | 1512 | 3.00% | 97.00% | 0.00% | 0.00% | NA |
Aus | 269 | 29.00% | 71.00% | 0.00% | 0.00% | NA |
Indica I | 595 | 95.80% | 3.70% | 0.50% | 0.00% | NA |
Indica II | 465 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
Indica III | 913 | 91.50% | 8.40% | 0.11% | 0.00% | NA |
Indica Intermediate | 786 | 88.40% | 11.30% | 0.25% | 0.00% | NA |
Temperate Japonica | 767 | 3.10% | 96.90% | 0.00% | 0.00% | NA |
Tropical Japonica | 504 | 3.60% | 96.40% | 0.00% | 0.00% | NA |
Japonica Intermediate | 241 | 1.70% | 98.30% | 0.00% | 0.00% | NA |
VI/Aromatic | 96 | 5.20% | 94.80% | 0.00% | 0.00% | NA |
Intermediate | 90 | 53.30% | 46.70% | 0.00% | 0.00% | NA |
Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
---|---|---|---|---|---|---|---|---|---|
vg0628275391 | G -> A | LOC_Os06g46560.1 | upstream_gene_variant ; 2458.0bp to feature; MODIFIER | silent_mutation | Average:70.576; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
vg0628275391 | G -> A | LOC_Os06g46570.1 | upstream_gene_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:70.576; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
vg0628275391 | G -> A | LOC_Os06g46580.1 | upstream_gene_variant ; 4958.0bp to feature; MODIFIER | silent_mutation | Average:70.576; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
vg0628275391 | G -> A | LOC_Os06g46570.2 | upstream_gene_variant ; 252.0bp to feature; MODIFIER | silent_mutation | Average:70.576; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
vg0628275391 | G -> A | LOC_Os06g46560-LOC_Os06g46570 | intergenic_region ; MODIFIER | silent_mutation | Average:70.576; most accessible tissue: Zhenshan97 panicle, score: 87.451 | N | N | N | N |
Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
---|---|---|---|---|---|---|
vg0628275391 | NA | 7.43E-06 | mr1305 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628275391 | NA | 3.36E-18 | mr1598 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628275391 | NA | 1.33E-06 | mr1748 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628275391 | NA | 2.71E-17 | mr1913 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628275391 | NA | 3.81E-06 | mr1990 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
vg0628275391 | NA | 4.99E-10 | mr1349_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |