\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628049712:

Variant ID: vg0628049712 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28049712
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.99, others allele: 0.00, population size: 107. )

Flanking Sequence (100 bp) in Reference Genome:


CGCGAACCGGTCCTTAATCGCCATGGGCACGACTAGCAAAATCATGCACCCACAGCTCACCATGTAGTGTATTTTAATTAACCAACACCATAGCGGTGGC[G/A]
CTAATCCAACAATACCATTAGAACCAACAGTCTAAACATTAATAGGATTCTCCCTATTGTGCACTAGTTGAACTAAGCATGGCTAAGCAATCCCTAGTCC

Reverse complement sequence

GGACTAGGGATTGCTTAGCCATGCTTAGTTCAACTAGTGCACAATAGGGAGAATCCTATTAATGTTTAGACTGTTGGTTCTAATGGTATTGTTGGATTAG[C/T]
GCCACCGCTATGGTGTTGGTTAATTAAAATACACTACATGGTGAGCTGTGGGTGCATGATTTTGCTAGTCGTGCCCATGGCGATTAAGGACCGGTTCGCG

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 27.80% 6.20% 9.18% 56.77% NA
All Indica  2759 1.80% 0.30% 14.35% 83.51% NA
All Japonica  1512 80.90% 12.80% 1.46% 4.89% NA
Aus  269 0.40% 1.50% 4.83% 93.31% NA
Indica I  595 1.30% 0.00% 7.73% 90.92% NA
Indica II  465 2.40% 0.00% 6.02% 91.61% NA
Indica III  913 0.90% 0.20% 24.86% 74.04% NA
Indica Intermediate  786 2.90% 0.90% 12.09% 84.10% NA
Temperate Japonica  767 77.10% 19.70% 0.00% 3.26% NA
Tropical Japonica  504 82.30% 6.00% 4.17% 7.54% NA
Japonica Intermediate  241 90.00% 5.00% 0.41% 4.56% NA
VI/Aromatic  96 14.60% 81.20% 1.04% 3.12% NA
Intermediate  90 30.00% 11.10% 2.22% 56.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628049712 G -> A LOC_Os06g46284.1 intron_variant ; MODIFIER silent_mutation Average:14.097; most accessible tissue: Callus, score: 26.174 N N N N
vg0628049712 G -> A LOC_Os06g46284.2 intron_variant ; MODIFIER silent_mutation Average:14.097; most accessible tissue: Callus, score: 26.174 N N N N
vg0628049712 G -> DEL N N silent_mutation Average:14.097; most accessible tissue: Callus, score: 26.174 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628049712 NA 1.19E-16 Awn_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0628049712 1.31E-10 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 5.30E-09 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 1.19E-07 NA mr1305 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 7.41E-07 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 9.04E-06 9.04E-06 mr1409 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 1.98E-06 1.45E-12 mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 7.18E-08 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 1.13E-10 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 2.71E-09 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 2.10E-06 NA mr1672 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 4.99E-07 NA mr1765 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 2.94E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 4.69E-07 NA mr1166_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 5.96E-06 5.96E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 5.83E-09 NA mr1305_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 7.33E-06 2.76E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 4.55E-08 6.44E-16 mr1585_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 3.26E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 3.58E-08 NA mr1672_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628049712 NA 8.44E-06 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251