Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg0628021635:

Variant ID: vg0628021635 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 28021635
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

CGGCGGTGGCGATGTACTCTCTCTGTTTCATAAAAAACAAACCTAGGATCAGATATGACATATTCTAATATAATAAATCTGAATATATATATATATATAT[G/A]
TAGATTCGTAATATATTCGGCACTAGTAGGTTGGTTTTTTATGGGACACTCGGGCGGCCAGCCCAATCATGTGAGGAAATCGTACCGAAAAGACCAGGCT

Reverse complement sequence

AGCCTGGTCTTTTCGGTACGATTTCCTCACATGATTGGGCTGGCCGCCCGAGTGTCCCATAAAAAACCAACCTACTAGTGCCGAATATATTACGAATCTA[C/T]
ATATATATATATATATATTCAGATTTATTATATTAGAATATGTCATATCTGATCCTAGGTTTGTTTTTTATGAAACAGAGAGAGTACATCGCCACCGCCG

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	63.40%	10.60%	3.87%	22.20%	NA
All Indica	2759	69.30%	1.70%	3.55%	25.44%	NA
All Japonica	1512	66.90%	28.30%	2.98%	1.85%	NA
Aus	269	2.60%	0.70%	8.18%	88.48%	NA
Indica I	595	91.40%	0.70%	1.18%	6.72%	NA
Indica II	465	88.00%	1.30%	1.94%	8.82%	NA
Indica III	913	49.90%	1.50%	5.59%	42.94%	NA
Indica Intermediate	786	64.00%	2.90%	3.94%	29.13%	NA
Temperate Japonica	767	91.50%	4.30%	3.00%	1.17%	NA
Tropical Japonica	504	32.10%	63.50%	2.38%	1.98%	NA
Japonica Intermediate	241	61.00%	31.10%	4.15%	3.73%	NA
VI/Aromatic	96	9.40%	8.30%	11.46%	70.83%	NA
Intermediate	90	61.10%	16.70%	7.78%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0628021635	G -> A	LOC_Os06g46250.1	upstream_gene_variant ; 1234.0bp to feature; MODIFIER	silent_mutation	Average:81.102; most accessible tissue: Minghui63 panicle, score: 99.553	N	N	N	N
vg0628021635	G -> A	LOC_Os06g46240.1	downstream_gene_variant ; 4145.0bp to feature; MODIFIER	silent_mutation	Average:81.102; most accessible tissue: Minghui63 panicle, score: 99.553	N	N	N	N
vg0628021635	G -> A	LOC_Os06g46260.1	intron_variant ; MODIFIER	silent_mutation	Average:81.102; most accessible tissue: Minghui63 panicle, score: 99.553	N	N	N	N
vg0628021635	G -> DEL	N	N	silent_mutation	Average:81.102; most accessible tissue: Minghui63 panicle, score: 99.553	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg0628021635	G	A	0.01	0.0	-0.01	-0.02	-0.01	-0.02

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0628021635	NA	8.06E-06	mr1277	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	2.82E-07	mr1042_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	2.31E-06	mr1277_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	4.06E-13	mr1364_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	3.81E-10	mr1471_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	7.70E-10	mr1543_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	1.08E-09	mr1582_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	5.83E-06	mr1582_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	5.15E-07	mr1680_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	6.56E-09	mr1742_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	1.71E-08	mr1871_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628021635	NA	2.70E-07	mr1966_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251