\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0628001136:

Variant ID: vg0628001136 (JBrowse)Variation Type: SNP
Chromosome: chr06Position: 28001136
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TTTCCCATCTCTCTTCTCTCTATCCTCTCCTTCCACACTACTTAGTCCGCGCCGCATCGCATCGCCTCCACGAGCCATGACCGACGCTGTTATCGCCGCC[G/A]
TGGCTTCCGCCGAAGAGGACGACGTCGCGGCTTTCTGCCGGAGAGGACGACGCCGCGTGGGAGCACGCCATTGCGGCGGTCATCAAGAAAGCCCCCTTCT

Reverse complement sequence

AGAAGGGGGCTTTCTTGATGACCGCCGCAATGGCGTGCTCCCACGCGGCGTCGTCCTCTCCGGCAGAAAGCCGCGACGTCGTCCTCTTCGGCGGAAGCCA[C/T]
GGCGGCGATAACAGCGTCGGTCATGGCTCGTGGAGGCGATGCGATGCGGCGCGGACTAAGTAGTGTGGAAGGAGAGGATAGAGAGAAGAGAGATGGGAAA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.70% 9.50% 0.87% 13.94% NA
All Indica  2759 79.30% 2.80% 1.20% 16.71% NA
All Japonica  1512 85.60% 10.50% 0.20% 3.64% NA
Aus  269 2.60% 46.80% 0.74% 49.81% NA
Indica I  595 93.10% 0.50% 0.34% 6.05% NA
Indica II  465 97.00% 1.10% 0.00% 1.94% NA
Indica III  913 68.00% 4.60% 2.19% 25.19% NA
Indica Intermediate  786 71.60% 3.30% 1.40% 23.66% NA
Temperate Japonica  767 80.20% 19.00% 0.00% 0.78% NA
Tropical Japonica  504 89.70% 0.80% 0.60% 8.93% NA
Japonica Intermediate  241 94.60% 3.70% 0.00% 1.66% NA
VI/Aromatic  96 14.60% 83.30% 0.00% 2.08% NA
Intermediate  90 82.20% 6.70% 3.33% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg0628001136 G -> A LOC_Os06g46210.1 upstream_gene_variant ; 1291.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0628001136 G -> A LOC_Os06g46200.1 downstream_gene_variant ; 1844.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0628001136 G -> A LOC_Os06g46230.1 downstream_gene_variant ; 2669.0bp to feature; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0628001136 G -> A LOC_Os06g46210-LOC_Os06g46230 intergenic_region ; MODIFIER silent_mutation Average:67.217; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N
vg0628001136 G -> DEL N N silent_mutation Average:67.217; most accessible tissue: Zhenshan97 panicle, score: 87.451 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg0628001136 NA 2.84E-08 Awn_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg0628001136 NA 6.37E-06 mr1006 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 5.27E-06 mr1052 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 3.14E-06 mr1057 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 3.51E-07 NA mr1062 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 1.79E-06 mr1062 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 9.84E-06 NA mr1166 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 9.21E-09 NA mr1210 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 5.26E-07 mr1210 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 6.93E-09 NA mr1305 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 3.43E-06 mr1305 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 9.50E-07 NA mr1409 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 5.53E-07 NA mr1515 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 6.94E-07 NA mr1585 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 2.78E-07 mr1585 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 1.16E-11 NA mr1586 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 7.11E-08 mr1586 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 2.52E-07 NA mr1765 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 1.82E-06 mr1765 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 5.65E-06 5.65E-06 mr1166_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 2.74E-07 NA mr1305_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 9.20E-08 mr1305_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 1.76E-08 mr1585_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 8.29E-09 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 4.01E-06 NA mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0628001136 NA 4.00E-07 mr1765_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251