Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg0627547379:

Variant ID: vg0627547379 (JBrowse)	Variation Type: SNP
Chromosome: chr06	Position: 27547379
Reference Allele: G	Alternative Allele: T
Primary Allele: G	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAAAAAATTGAATGGTAGAGGGGTTATGGTTGGTTGGAAAGAGAATCTATGTTTTTGGAAAAAAATTAAAGCCCATAAGTTATTATATTTTAGGACGGA[G/T]
GAGTAGAAGTTGTAGTATATTTTAGGCTCTCATCGGATGGCCTAATCAGCCAAAGAAAAAGCCAAATTTTAAATTTTCAAACTTAATTTGGAGATTGATT

Reverse complement sequence

AATCAATCTCCAAATTAAGTTTGAAAATTTAAAATTTGGCTTTTTCTTTGGCTGATTAGGCCATCCGATGAGAGCCTAAAATATACTACAACTTCTACTC[C/A]
TCCGTCCTAAAATATAATAACTTATGGGCTTTAATTTTTTTCCAAAAACATAGATTCTCTTTCCAACCAACCATAACCCCTCTACCATTCAATTTTTTCA

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	97.90%	1.50%	0.55%	0.00%	NA
All Indica	2759	100.00%	0.00%	0.00%	0.00%	NA
All Japonica	1512	93.90%	4.40%	1.65%	0.00%	NA
Aus	269	100.00%	0.00%	0.00%	0.00%	NA
Indica I	595	100.00%	0.00%	0.00%	0.00%	NA
Indica II	465	100.00%	0.00%	0.00%	0.00%	NA
Indica III	913	100.00%	0.00%	0.00%	0.00%	NA
Indica Intermediate	786	99.90%	0.10%	0.00%	0.00%	NA
Temperate Japonica	767	99.20%	0.10%	0.65%	0.00%	NA
Tropical Japonica	504	83.70%	12.90%	3.37%	0.00%	NA
Japonica Intermediate	241	98.30%	0.40%	1.24%	0.00%	NA
VI/Aromatic	96	96.90%	2.10%	1.04%	0.00%	NA
Intermediate	90	96.70%	3.30%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg0627547379	G -> T	LOC_Os06g45530.1	upstream_gene_variant ; 3070.0bp to feature; MODIFIER	silent_mutation	Average:29.682; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N
vg0627547379	G -> T	LOC_Os06g45530-LOC_Os06g45540	intergenic_region ; MODIFIER	silent_mutation	Average:29.682; most accessible tissue: Minghui63 panicle, score: 50.413	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg0627547379	1.39E-06	3.79E-10	mr1076	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	3.00E-10	mr1082	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	2.62E-07	2.13E-11	mr1083	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	4.05E-06	4.05E-06	mr1145	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	3.00E-09	mr1226	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	3.53E-08	mr1227	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	9.94E-07	NA	mr1301	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	7.74E-06	mr1408	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	4.61E-06	NA	mr1410	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	4.09E-06	1.08E-07	mr1411	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	1.96E-06	mr1560	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	1.06E-06	mr1878	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	1.62E-06	2.09E-08	mr1082_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	3.84E-06	mr1083_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	4.38E-06	1.44E-06	mr1104_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	8.72E-06	mr1220_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	2.80E-06	1.30E-08	mr1226_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	1.50E-07	NA	mr1301_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	NA	6.69E-07	mr1363_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	4.91E-06	NA	mr1410_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg0627547379	1.58E-06	NA	mr1993_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251